Information

Hur produceras Taq-polymeras?

Hur produceras Taq-polymeras?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Jag har sett Taq polymeras marknadsförs som antingen "nativt" eller "rekombinant". Jag förstår att den rekombinanta versionen produceras av speciellt modifierad Escherichia coli stammar som har genen för polymerasproduktion skarvad i sig, men jag undrar över den "native" varianten. Jag föreställer mig det Thermus aquaticus är ganska svår att odla i ett medium; är det sålunda sant att arkéerna måste extraheras från källorna de kom ifrån för att producera "nativt" polymeras?


För rekombinant Taq polymeras, produktion i industriell skala producerar liter högkoncentrerat enzym i en enda körning. Den kommer i så små, utspädda kvantiteter när den säljs att endast ett fåtal förberedelser per år skulle behövas för att tillfredsställa forskningslaboratoriets efterfrågan.

Jag vet inte Thermus aquaticus protokoll, men med tanke på prestationerna i avkastning för E coli, och den minimala prisskillnaden mellan de två enzymerna, skulle jag föreställa mig att avkastningen är liknande där. Det skulle säga för mig att ingen odlar varma källor för T. aquaticus.


En enkel och effektiv metod för extraktion av Taq DNA-polymeras

Termostabilt DNA-polymeras (Taq Pol Ι) från Thermus aquaticus har använts flitigt i PCR, som vanligtvis extraherades med Pluthero's metod. Metoden använde ammoniumsulfat för att fälla ut enzymet, och det sparade ansträngning och pengar men inte tid. Dessutom fann vi att 30–40% aktivitet av Taq Pol I gick förlorad vid ammoniumsulfatutfällningssteget, och produkten innehöll en liten mängd DNA.

Resultat

Vi tillhandahöll en ny, förenklad och billig metod för att rena Taq Pol Ι efter överproduktion av enzymet i Escherichia coli, som använde etanol istället för ammoniumsulfat för att fälla ut enzymet. Fällningen kan lösas direkt i lagringsbufferten utan dialys. Dessutom avlägsnades DNA- och RNA-kontamination med DNas I och RNas A före utfällning, och extraktionsproceduren optimerades. Våra förbättringar ökar återhämtningshastigheten och enzymets specifika aktivitet och sparar arbete, tid och kostnader.

Slutsatser

Vår metod använder etanol, DNase I och RNase A för att rena Taq Pol Ι, och förenklar operationen och ökar enzymåtervinningshastigheten och kvaliteten.


Taq DNA-polymeras (klonat)

Taq DNA-polymeras är ett enzym med en enda subenhet som renats från den termofila bakterien Thermus aquaticus, det naturliga enzymet uttryckt i E coli. Den polymeriserar DNA från en primer som hybridiserats med en DNA-mall i närvaro av dNTP för PCR.

  • Högrenat rekombinant enzym.
  • Utmärkt batch-till-batch-reproducerbarhet.
  • Varje parti testas för att vara fritt från nukleaskontamination.

Taq DNA-polymeras (klonad) är den rekombinanta (segment av DNA från olika källor sammanfogade) formen av det naturliga enzymet, uttryckt i E coli. Detta fungerar som en energikälla för cellulära reaktioner och är involverat i signalvägar.

Eftersom Taq DNA Polymerase (klonat) är ett exceptionellt rent rekombinant protein, ger det utmärkt reproducerbarhet från batch-till-batch, vid en optimal temperatur på 75°C, med förmågan att överleva upprepade inkubationer vid >95°C.

Taq DNA Polymerase är licensierad för användning i PCR och testas omfattande för kontaminerande nickas, enkel- och dubbelsträngat exonukleas och endonukleasaktiviteter.


Taq PLUS DNA-polymeras (3 citat)

Taq Plus DNA Polymerase är en blandning av Taq DNA Polymerase och Pfu, ett korrekturläsande DNA-polymeras, som möjliggör amplifiering av långa mallar, upp till 20 kb, med hög kvalitet. De två enzymerna verkar synergistiskt under PCR för att generera mer exakta och längre PCR-produkter med högre utbyte jämfört med enbart Taq DNA-polymeras. PCR-produkter, amplifierade upp till 20 kb i längd med Taq Plus DNA Polymerase, innehåller en blandning av trubbiga ändar och enkelbas (A) 3&rsquo överhäng. Felfrekvensen för denna PCR-amplifiering är 7,5x10-5 per nukleotid per cykel.

LAGRING BUFFERT

20 mM Tris.HCl (pH 8,0), 100 mM KCl, 3 mM MgCl2, 1 mM DTT, 0,1 % Nonidet® P-40, 0,1 % Tween® 20, 0,2 mg/ml BSA, 50 % (v/v) glycerol.

10X PCR-BUFFER

100 mM Tris-HCl (pH 8,8), 500 mM kaliumklorid, 1 % Triton® X-100, 16 mM MgCl2.

ENHETSDEFINITION

En enhet (U) definieras som mängden enzym som behövs för att katalysera inkorporeringen av 10 nanomol deoxiribonukleotider i syraolösligt material på 30 minuter vid 70°C med hjälp av sillsperma-DNA som substrat.


Vad är Taq Polymeras

Taq polymeras är ett kommersiellt tillgängligt, termostabilt DNA-polymeras som används i PCR för att syntetisera DNA. Det härrör från eubakterien som kallas Thermus aquaticus. Bakteriens naturliga livsmiljö är varma termiska källor med omgivningstemperaturer på 70-75 °C. Strukturen av Taq polymeras visas i Figur 1.

Figur 1: Taq-polymeras

Taq polymeras är ett 94 kD DNA-beroende DNA-polymeras, som är homologt med DNA-polymeras 1 i E coli. Därav, Taq polymeras är sammansatt av 3′ -OH-nukleotidadditionsstället, dNTP/DNA-bindningsstället och exonukleasstället 5′ till 3′. Den saknar dock 3′ till 5′ exonukleasdomän för korrekturläsning av inkommande nukleotider.


Slutsatser

För att sammanfatta, en fusion NeqSSB-TaqS DNA-polymeras bestående av Taq Stoffel DNA-polymeras och NeqSSB-liknande protein av Nanoarchaeum equitans uppvisar en mycket högre förlängningshastighet, erbjuder högre processivitet och har en högre tolerans mot PCR-hämmare jämfört med Taq Stoffel DNA-polymeras. Av denna anledning kan det i många PCR-applikationer vara bättre att använda en NeqSSB-TaqS DNA-polymeras istället för a Taq DNA-polymeras.


Taq enzym

Ett taq-enzym är ett bakteriellt enzym som fungerar vid tillverkning av deoxiribonukleinsyra (DNA ). Enzymets förmåga att fungera vid högre temperaturer än andra liknande fungerande bakterier enzymer har gjort det värdefullt i polymeraskedjereaktion .

Monikern taq betecknar enzymets ursprung. Enzymet produceras av en bakterie som kallas Thermus aquaticus. Denna bakterie upptäcktes av Thomas Brock i mitten av 1970-talet i det nästan kokande vattnet i Mushroom Pool, en varm källa i Yellowstone National Park

Taq är ett DNA-polymeras. Enzymet tillverkar en DNA-sträng som är komplementär till en enkel DNA-sträng. Allt bakterie besitter DNA-polymeras. Anledningen till att taq-polymeraset har blivit så betydelsefullt för biotekniska processer är på grund av enzymets motståndskraft mot värme. A molekylärbiologi teknik känd som polymeraskedjereaktionen bygger på exponering av DNA för värme för att separera de två strängarna i dubbelhelixen. Taq kan sedan använda båda enkelsträngarna som mallar för tillverkning av två nya DNA-strängar. För att utföra denna funktion kan polymeraset känna igen den speciella byggstenen, eller nukleotiden, på DNA-enkelsträngen och sedan placera en nukleotid som är den komplementära matchningen till det specifika målet. Bindning av de två nukleotiderna sker. Polymeraset kan sedan gå vidare till nästa nukleotid och processen upprepas. När DNA-blandningen tillåts svalna länkar de matchande strängarna samman och bildar två dubbelsträngade helixar av DNA. Om denna process upprepas många gånger kan ett stort antal kopior av målregionen av DNA tillverkas. Värmebeständigheten hos taq gör att enzymet kan fungera under temperaturförhållanden som håller DNA-strängarna isär från varandra. DNA-polymeraset från andra bakterier, till exempel från bakterien Escherichia coli, fungerar inte alls lika effektivt i polymeraskedjereaktionen som taq-polymeraset av Thermus aquaticus.

Sedan upptäckten av taq-enzymet och utvecklingen av polymeraskedjereaktionen har enzymets betydelse för molekylärbiologisk forskning och kommersiella tillämpningar av bioteknik har skjutit i höjden. Taq-polymeras används i stor utsträckning vid molekylär diagnos av sjukdomar och inom kriminalteknik ("DNA-fingeravtryck"). Dessa och andra tillämpningar av taq har skapat en industri värd hundratals miljoner dollar årligen.

Se även DNA (Deoxiribonukleinsyra) DNA-hybridisering Extremofiler Molekylärbiologi och molekylärgenetik PCR


Felfrekvensjämförelse under polymeraskedjereaktion med DNA-polymeras

När kloningsprojekt i större skala blir vanligare, finns det ett ökande behov av jämförelser mellan högtrogna DNA-polymeraser som används för PCR-amplifiering. Alla polymeraser som marknadsförs för PCR-tillämpningar testas för tillförlitlighetsegenskaper (d.v.s. bestämning av felfrekvens) av leverantörer, och många litteraturrapporter har behandlat PCR-enzymtrohet. Ändå är det ofta svårt att göra direkta jämförelser mellan olika enzymer på grund av många metodologiska och analytiska skillnader från studie till studie. Vi har mätt felfrekvensen för 6 DNA-polymeraser som vanligtvis används i PCR-tillämpningar, inklusive 3 polymeraser som vanligtvis används för kloningsapplikationer som kräver hög trohet. Felhastighetsmätvärden som rapporterats här erhölls genom direkt sekvensering av klonade PCR-produkter. Strategin som används här tillåter utfrågning av felfrekvens över ett mycket stort DNA-sekvensutrymme, eftersom 94 unika DNA-mål användes som mallar för PCR-kloning. De sex enzymer som ingår i studien, Taq polymeras, AccuPrime-Taq High Fidelity, KOD Hot Start, klonad Pfu polymeras, Phusion Hot Start och Pwo polymeras hittar vi de lägsta felfrekvenserna med Pfu, Phusion och Pwo polymeraser. Felfrekvensen är jämförbar för dessa 3 enzymer och är >10x lägre än felfrekvensen som observerats med Taq polymeras. Mutationsspektra rapporteras, med de 3 high fidelity-enzymerna som uppvisar i stort sett liknande typer av mutationer. För dessa enzymer dominerar övergångsmutationer, med liten bias observerad för typ av övergång.

1. Introduktion

Med den snabba utvecklingen inom systembiologibaserad forskning, till exempel genomik, proteomik och metabolomik, blir större biologiska upptäcktsprojekt allt vanligare. Med andra ord har omfattningen av många projekt förändrats från att studera ett eller ett fåtal mål till att studera hundratals, tusentals eller fler. Ett exempel på forskning som har förändrats av utvecklingen inom systembiologi är kloning av uttryckta öppna läsramar (ORF) från cDNA-substrat. Den traditionella vägen för ORF-kloning har vanligtvis börjat med experimentella observationer som driver identifieringen av en eller flera gener av intresse för en viss väg. Kloning av mål resulterade sedan typiskt i ytterligare förfining av vägdetaljer och ofta identifiering av nya kloningsmål. Med skapandet och ständiga förbättringar av databaser med genomiska sekvenser, sker kloning nu ofta i mycket större skala. Microarray-teknik och genombrott för DNA-sekvensering har lett till en enorm ökning av antalet ORF som finns i biologiska databaser. Dessutom föregår biologiska observationer inte längre nödvändigtvis målidentifiering, som nu ofta till stor del drivs av bioinformatikbaserade förutsägelser och analyser. Exempel på storskaliga kloningsinsatser inkluderar strukturella genomikprojekt för att systematiskt bestämma proteinstrukturer [1], patogen ORF-kloning för att förstå sjukdomar och terapeutiska mekanismer [2] och skapande av hela det mänskliga ORFeome som kommer att vidareutveckla utvecklingen inom grundläggande och tillämpade biomedicinska vetenskaper [3].

DNA-polymeraser som används för att amplifiera mål under PCR-kloning är högtrogna enzymer med felfrekvenser vanligtvis inom intervallet

mutationer/bp amplifierad [4]. Att minimera PCR-genererade fel är särskilt viktigt för kloningsprojekt i större skala eftersom, givet en tillräckligt stor pool av mål-DNA-sekvenser, kommer även high fidelity-enzymer att producera kloner med mutationer. Det finns en mängd olika metoder för att analysera troheten hos ett DNA-polymeras. Felfrekvenser för PCR-enzymer analyseras emellertid nästan alltid med användning av ett (eller ett fåtal) definierat DNA-mål som provar en begränsad del av DNA-sekvensutrymmet. Tidiga studier med relativt låg trohet Taq DNA-polymeras förlitade sig på sekvensering av klonade PCR-produkter (t.ex. [5, 6]). Direkt sekvensering av kloner var ett praktiskt tillvägagångssätt vid den tiden på grund av polymerasets låga trohet, det vill säga de flesta kloner som sekvenserades skulle innehålla minst en mutation.

Med introduktionen av polymeraser med högre kvalitet utvecklades nya screeningmetoder för att snabbt undersöka ett stort antal PCR-produkter för närvaron av mutationer. Dessa analyser baserades på en framåtmutationsfidelitetsanalys utvecklad av Kunkel och kollegor, som använde en luckfyllande reaktion med ett DNA-polymeras på en lacZ mallsekvens, följt av ligering och transformation till E coli. Kolorimetrisk screening baserad på en funktionell lacZ genen möjliggjorde snabb identifiering av mutationer, som sedan sekvenserades för att bestämma arten av DNA-förändringen [7]. Ett liknande tillvägagångssätt användes för att screena PCR-produkter för mutationer, genom att klona en lacZ fragment amplifierat med PCR i motsats till enkel luckfyllning av DNA-polymeraser. Denna metod, ibland med användning av en annan reportergen, har använts för att screena en mängd olika high fidelity PCR-enzymer och för att optimera PCR-reaktionsförhållanden för att minimera mutationer [4, 8]. Slutligen har metoder som bygger på analys av PCR-mutationer baserade på olika kemiska egenskaper (dvs smälttemperatur) hos reaktionsprodukter med felmatchningar i förhållande till perfekta duplex utvecklats och tillämpats på en mängd olika enzymsystem [9, 10]. Medan rapporterade trohetsvärden skiljer sig åt mellan forskargrupper och analysmetoder, finns det en allmän konsensus om att ett relativt lågfidelitetsenzym som t.ex. Taq har ett trohetsvärde i

intervall och högre fidelity-enzymer har värden som ligger inom intervallet (vanligtvis rapporterade som mutationer per bp per mallfördubbling).

En avvägning involverad i att använda screeningmetoder som de som beskrivs ovan är att i allmänhet endast en DNA-sekvens förhörs under analysen. Dessutom begränsar begränsningar inbyggda i analyserna ytterligare de möjliga mutationer som kan detekteras. Till exempel analysen baserad på screening lacZ genamplifieringsprodukter använder ett enda 1,9 kb mål, varav endast 349 baser kommer att producera en färgförändring när de muteras [11]. Likaså är analys av mutationer baserade på differentiella duplexsmältningsprofiler begränsad till unika målsekvenser som är tillräckligt korta, vanligtvis i intervallet 100–300 bp, och har termiska smältprofiler som tillåter upplösning av enstaka felparningar [9, 10].

Eftersom polymerasfel är kända för att vara starkt beroende av DNA-sekvenskontext (granskas i [12]), skulle man helst använda en stor uppsättning DNA-sekvenser när man mäter enzymtrohet. Detta blir särskilt relevant i samband med storskaliga kloningsprojekt, som involverar hundratals eller tusentals mål och därmed innehåller ett nästan oändligt DNA-sekvensutrymme. För detta ändamål har vi designat och genomfört en studie som mäter enzymtrohet genom direkt sekvensering av klonade PCR-produkter. Fallande kostnader för DNA-sekvensering har gjort denna metod för trohetsbestämning praktisk, även för enzymer som gör få misstag. Våra mål är att jämföra trohetsvärden härledda från direkt klonsekvensering med de som härrör från screeningbaserade metoder, samt att utvärdera dessa resultat i samband med att välja ett enzym för ett kloningsprojekt med hög genomströmning.

2. Resultat och diskussion

För att bestämma felfrekvenser och observera mutationsspektra för en mängd olika DNA-polymeraser som används i PCR-kloning, sekvenserade vi direkt kloner producerade från 94 olika plasmidmallar. Dessa plasmider, var och en med en unik mål-DNA-sekvens, är en undergrupp av en större grupp av glykosyltransferaskloner som vi har framställt från Arabidopsis thaliana cDNA (manuskript under förberedelse). De 94 plasmiderna har insättningar med storlek som sträcker sig från 360 bp till 3,1 kb (median 1,4 kb) och GC-innehåll som sträcker sig från 35 % till 52 % (median 44 %). En sammanfattning av de 6 DNA-polymeraser som används i denna studie presenteras i tabell 1. Vi inkluderade Taq polymeras i vår studie på grund av den omfattande mängd litteratur som finns om detta enzyms trohetsegenskaper. De andra enzymerna som ingår är alla vanligtvis klassificerade som "high fidelity" och är därför potentiella kandidater för storskaliga kloningsprojekt. Och även om det är svårt att jämföra trohetsvärden på grund av skillnader i analys- och kvantifieringsmetoder mellan olika studier, verkar en allmän rankning av de enzymer som studeras här (lägsta till högst) vara Taq < AccuPrime-Taq < KOD

Pfu Pwo < Phusion.

Vår kloningspipeline använder rekombinationsinförande av renade PCR-produkter i en plasmidvektor med hjälp av Gateway-kloningssystemet, en metod som ofta används för kloningsstudier med hög genomströmning (granskas i [17]). Eftersom våra ingående plasmid-DNA-mallar framställdes med hjälp av Gateway-systemet, flankeras målgenerna av intresse alla av att rekombinationssekvenser. Detta möjliggjorde användningen av gemensamma primrar för alla PCR-reaktioner, vilket eliminerade behovet av målspecifika optimeringar. Renat plasmid-DNA användes som mall för PCR, och i alla fall användes buffertar som rekommenderas av säljaren. Vi använde små mängder plasmidmall (25 pg/rxn), för att maximera antalet fördubblingar i PCR-reaktionen, och storleken på insättningen i förhållande till den totala plasmidstorleken togs i beaktande för att bestämma mängden målfragment som finns i mallen. PCR-protokollet använde 30 cykler av amplifiering, med en förlängningstid på 2 minuter/cykel för mål ≤2 kb (82 av 94 mål) och 4 minuter/cykel för mål >2 kb (12 av 94 mål). Figur 1 visar gelbilder för en representativ uppsättning PCR-reaktioner för varje enzym. I samtliga fall observerades ett enda större produktband som migrerade vid den förväntade storleken. Amplifieringseffektiviteten mättes genom kvantifiering av PCR-produkt med användning av ett dsDNA-specifikt färgämne och beräkning av veckamplifieringen baserat på en känd kvantitet av ingående DNA-mall. Vikningsförstärkningen används för att bestämma antalet mallfördubblingar som inträffade under PCR. Som rapporterats i tabell 2 var amplifieringseffektivitetsvärdena ganska enhetliga för alla prover i en platta. Vi observerar liknande amplifieringseffektivitet mellan olika enzymer, med undantaget att vi rutinmässigt observerade färre mallfördubblingar i reaktioner med Pfu polymeras. Vi har hållit termocyklingsprotokollen konstanta för alla enzymer, och därför är det möjligt att vissa parametrar inte var optimala för amplifiering av Pfu.

) är medelvärdet av fördubblingsvärdena för var och en av de 94 PCR-reaktionerna i en platta, där fördubblingar beräknas från formeln

= (ng DNA efter PCR/ng DNA-inmatning). Felfrekvens (f) beräknas som f =

är antalet mutationer som observerats för alla kloner som sekvenserades och (målstorleken ×

för varje mål som klonades.


Representativa agarosgelelektroforesbilder av produkter av PCR-amplifiering av 24 unika DNA-mål, med sex olika enzymer. Varje bana innehåller 1/25 av hela PCR-reaktionen. Förväntade produktstorlekar sträcker sig från 1,4 till 1,7 kb i storlek.

Efter amplifiering renades PCR-produkter genom utfällning med PEG/MgCl2, som är känd för att selektivt fraktionera DNA på basis av storlek [18], för att avlägsna korta produkter <300 bp i storlek. Detta utfällningssteg kan utföras i 96-brunnars plattformat, vilket är ett krav när antalet prover blir stort. Vi har antagit detta protokoll för rutinanvändning och har observerat en högre effektivitet för införande av DNA av korrekt storlek i vektorn jämfört med rening med kit-baserade PCR-reningar, som vanligtvis har storleksgränser på

100 bp (data visas inte). I de fall där off-target PCR-produkter på >300 bp är närvarande, används gelextraktion för att isolera den önskade produkten. Renade PCR-produkter inkuberades med vektor-DNA och BP Clonas II och transformerades till kompetenta celler. Tre kolonier per platta plockades och växte upp i 96-brunnars plattor, och kulturer screenades för insättning av korrekt storlek genom koloni-PCR. Insättningseffektivitetsvärden för BP Clonase II, uttryckt som det genomsnittliga antalet kloner med en insättning vid/nära den förväntade storleken (av 3 kolonier screenade per transformation), var typiskt 80–90 % (data visas inte). För varje mål odlades en eller flera kloner för varje mål innehållande en insättning av korrekt storlek (om den erhölls) och användes för DNA-sekvensering.

För metodvalideringsändamål använde vi Taq DNA-polymeras, en familj A DNA-polymeras och enzymet som användes i de tidigaste PCR-experimenten [6]. Som en tidig arbetshäst inom PCR-teknik, Taq polymeras har studerats omfattande i syfte att bestämma trohet. Taq DNA-polymeras saknar en 3′→5′ exonukleasaktivitet och kan därför inte korrigera felinkorporerade nukleotider som uppstår under DNA-syntes. Olika analyser har använts för att analysera Taq trohet och, beroende på vilken metod som används, felfrekvensvärden (uttryckt som mutationer per baspar per mallduplicering) för Taq polymeras sträcker sig från

(t.ex. [7, 20]). Dessutom mutationsspektrumet av Taq polymeras har karakteriserats, med A•T → G•C-övergångar dominerande på grund av benägenheten för enzymet att felinkorporera inkommande dCTP med en mall-tyminnukleotid [6, 9, 21].

Genom direkt sekvensering av kloner från två oberoende PCR-experiment med Taq polymeras, observerade vi 99 unika mutationer av >100 kbp mål-DNA-sekvens. Typen och antalet individuella mutationer anges i tabell 3. Givet amplifieringseffektiviteten för varje PCR-reaktion, är felfrekvensen (genomsnitt av 2 experiment) för Taq polymeras är

mutationer/bp per mallduplicering. Detta värde är i utmärkt överensstämmelse med andra publicerade värden för detta enzym, och den relativt höga variansen tyder på att beräknade felvärden som skiljer sig upp till 2-faldigt förmodligen inte är signifikanta i förhållande till det experimentella bruset. Majoriteten av mutationerna (67 av 99) är A•T → G•C-övergångar, som kan vara resultatet av antingen inkommande dCTP-felparning med mall A eller inkommande dGTP-felparning med mall T. Övergångar av G•C→A•T-typen , till följd av antingen inkommande TTP-felparning med mall G eller inkommande dATP-felparning med mall C, är den näst vanligaste mutationen (28 av 99). Det fanns 3 transversionsmutationer, med 1 A•T→T•A och 2 A•T→C•G förändringar. Sammantaget överensstämmer spektrumet av bassubstitutionsmutationerna väl med tidigare observationer om Taq polymeras rapporterats i litteraturen [7]. Det observerades bara en insertion eller deletion (indel) mutation i vår datamängd, en enda T-deletion i en

mallsekvens. Taq polymeras har rapporterats producera indelmutationer med en betydande frekvens, så mycket som cirka 25% av de totala mutationerna, med alla förekommande i homopolymera körningar [7]. Eftersom vår målpool innehåller 1481 instanser av homopolymerkörningar på minst 4 bp, misstänker vi att andra skillnader mellan de tidigare analysförhållandena och de som används här förklarar avvikelsen. Specifikt utfördes de tidigare experimenten med förhöjt magnesium (10 mM mot 1,5 mM används här) och förhöjda dNTP-nivåer (1 mM mot 0,2 mM används här). Både förhöjda magnesium- och dNTP-nivåer visades därefter höja ramskifte (indel) mutationer företrädesvis i förhållande till bassubstitutionsmutationer [21].

En viktig kontroll för dessa experiment är nödvändig av metoden som används för att generera mall för DNA-sekvensering. För större kloningsprojekt är DNA-sekvensering med cellkultur fördelaktigt på grund av besparingen i tid och resurser i förhållande till att rena plasmid-DNA. Sekvensering med cellkultur kräver dock en PCR eller ett annat amplifieringssteg, och detta steg kan i princip vara en källa till "ytterligare mutation". För att ta itu med detta direkt sekvenserade vi miniprep-DNA framställt från en undergrupp av kloner producerade med Taq polymeras. Var och en av de fjorton mutationerna som detekterades i undergruppen med användning av cellkultur som källa för sekvenseringsmall observerades också vid sekvensering från plasmid-DNA-mall (data visas ej). Vi drar slutsatsen att vår metod har en falsk positiv frekvens på <7% (1/14) och är acceptabel för analys av PCR-inducerade mutationer. Dessutom baserat på våra resultat med Taq polymeras, drar vi slutsatsen att vår metod för trohetsbestämning ger resultat i utmärkt överensstämmelse med andra studier och är således ett korrekt mått på polymerasnoggrannhet.

Våra resultat visar att 3 av enzymerna som ingår i studien, Pfu polymeras, Phusion Hot Start och Pwo polymeras, har felfrekvenser som är betydligt lägre än de andra. Detta överensstämmer med tidigare fynd som visar mycket högtrogen PCR-amplifiering för dessa enzymer. Intressant nog är felfrekvensvärdena för dessa tre enzymer extremt lika varandra, ungefär 2-3 × mutationer/bp/mallfördubbling. De små felfrekvensvärdesskillnaderna är förmodligen inte signifikanta, med tanke på att det lilla antalet mutationer produceras av dessa högtrogna polymeraser utöver den experimentella variabiliteten som diskuterats ovan för resultaten med Taq. Med tanke på kostnaderna för kloning och sekvensering och ändliga forskningsbudgetar genererar mutationsdetektering genom DNA-sekvensering av kloner en relativt liten datamängd av mutationer när enzymtroheten är hög. Detta är en nackdel med vår analys, och trots att kostnaderna för DNA-sekvensering fortsätter att sjunka är screening av bakterier fortfarande en mycket mer ekonomisk metod för att förhöra ett stort antal kloner. För alla mutantkloner som produceras av Pfu, Phusion Hot Start och Pwo polymeraser, omsekvenserades prover för att utesluta provbearbetning eller DNA-sekvensering som en felkälla. I alla fall var den ursprungliga mutationen närvarande, vilket bekräftar PCR-reaktionen som den mest sannolika källan till mutationen. Ur användningssynpunkt i ett storskaligt kloningsprojekt skulle vilket som helst av dessa enzymer vara acceptabelt, bedömt utifrån kriterierna för att minimera felfrekvensen. Andra faktorer måste naturligtvis beaktas, såsom amplifieringseffektivitet, mutationsspektra, prestanda med mallar med högt GC-innehåll och kostnad, för att nämna några. När det gäller mutationsspektra producerade de 3 högtrogna polymeraserna alla huvudsakligen (>75%) övergångsmutationer, utan någon signifikant mallbias. Med Phusion-enzym observerade vi 15% (2/13) indelmutationer, vilket är problematiskt för kloningsapplikationer där translationsläsram bör bibehållas. Båda indelmutationerna inträffade i upprepade regioner, där den ena är en A-insättning i en

mallsekvens och den andra är en (TCT) deletion inom en

mallsekvens. Detta resultat var oväntat i ljuset av den höga processiviteten hos Phusion-polymeras i förhållande till andra vanliga PCR-enzymer (leverantörens webbplats). Eftersom flera studier har funnit att ökad polymerasprocessivitet minskar frekvensen av glidningsmutationer som resulterar i indelmutationer [22, 23], förväntade vi oss att Phusion skulle producera minst av denna klass av fel. Det bör dock noteras att denna slutsats är baserad på en liten provstorlek och ett större antal mutationer bör analyseras för bekräftelse.

Det var intressant för oss att inget av enzymerna som testades här visade sig ha en felfrekvens nedan

2 × . Andra studier i litteraturen har rapporterat sub-10 -6 felfrekvenser för PCR-enzymer,

[10] för Pfu polymeras analyserat med differentiell duplex Tm mätning och 4,2 × för Phusion, med HF-buffert analyserad med en metod som kallas BEAMING [16]. För studien av Phusion-trohet använde PCR en annan buffert än den som används här, vilket enligt leverantören faktiskt resulterar i en 2-3 gånger lägre felfrekvens. Dessutom använder den studien BEAMING-metoden, ett extremt känsligt flödescytometriskt protokoll som screenar ett stort antal pärlor som innehåller PCR-produkter för närvaron av nukleotidvariationer. Emellertid förhördes endast en specifik mutation, en G•C → A•T mutation vid en enda position, i den studien. Sålunda, även om analysen är extremt känslig för detektion av definierade mutationer, kanske resultat erhållna med BEAMING-metoden för mutationsfrekvens vid en enda position inte nödvändigtvis återspeglar ett enzyms trohetsegenskaper för mycket större sekvensutrymmen. För studien på Pfu felfrekvens, finns flera grundläggande metodologiska skillnader: i den tidigare studien utfördes PCR under "nästan anaeroba" förhållanden med betydligt kortare cykeltider, målstorleken begränsades till 93 bp och mutationsdetektering förlitade sig på en fysiokemisk metod: separation och isolering av PCR-produkter som innehåller felparningar genom kapillärelektrofores [10]. Och även om denna metod framgångsrikt har använts för att detektera sällsynta mutationer i mitokondriella DNA-prover från normala vävnader och cancervävnader [24], kan kravet på att en mutation resulterar i en molekyl med en förändrad smältprofil påverka antalet mutationer som kan upptäckas. En stor diskrepans mellan våra resultat och de från denna tidigare rapport om Pfu trohet, som kan vara kopplad till de olika mutationsdetektionsmetoderna, kan ses i mutationsspektraresultaten i tabell 3. Vi observerade

90 % (8 av 9) övergångsmutationer, med en liten bias för G•C → A•T förändringar. Däremot resulterade studien med användning av kapillärelektrofores för detektion i övervägande (3/5) transversionsmutationer, med en enda A•T → G•C-övergång och en enda 1 bp deletionsmutation. Transversionsmutationer kräver att polymeraset syntetiserar antingen en purin•purin- eller en pyrimidin•pyrimidin-felparning, vilka båda är signifikant ogynnsamma i förhållande till de olika purin•pyrimidin-felparningarna i familj B-polymeraser, inklusive Pfu polymeras [25, 26]. Eftersom de typer av mutationer vi observerar överensstämmer med tidigare rapporterade mutationsspektra för andra familje B-polymeraser, tror vi att vår metod har upptäckt polymerasfel på ett partiskt sätt.

De andra två enzymerna som ingår i vår studie, KOD-polymeras och AccuPrime-Taq High Fidelity, har trohetsvärden mellanliggande Taq polymeras och enzymerna med högre kvalitet. Felfrekvensen som observerades för KOD-polymeras var endast

4 gånger lägre än den för Taq polymeras och

2,5 gånger högre än för Pfu polymeras. Den första rapporten om trohet hos KOD-polymeras, ett familj B/pola-liknande polymeras från Thermococcus kodakaraensis KOD1, rapporterade en felfrekvens mycket något lägre än Pfu polymeras och

4 gånger lägre än för Taq polymeras [13]. Den studien använde en framåtmutationsanalys (inte PCR), uttryckte trohet helt enkelt som förhållandet mellan vita kolonier och blått utan att ta hänsyn till PCR-amplifieringseffektiviteten, och använde experimentella förhållanden (Mg 2+ koncentration) som skiljer sig signifikant från typiska PCR-förhållanden. En efterföljande studie som mätte trohet under PCR-förhållanden, med användning av en annan reportergen men fortfarande ett enkelt förhållande mellan mutant- och vildtypskolonier, rapporterade felfrekvenser

50x lägre än de med Taq och marginellt lägre än de för Pfu polymeras [14]. I ingen av dessa studier fanns det en rapport om de molekylära förändringarna som ledde till mutantkolonier. Den stora skillnaden mellan dessa två resultat, som kommer från samma forskargrupp, tjänar till att belysa svårigheterna med att göra jämförelser mellan studier där det finns betydande metodologiska skillnader. In the present study, we find that the mutation spectrum for KOD polymerase is similar to the other B-family polymerases (Pfu, Pwo, and Phusion) assayed here. As shown in Table 3, transitions predominate (14 of 16 mutations), with a slight bias (64%) for A•T → G•C mutations.

For the PCR performed with AccuPrime-Taq High Fidelity system, we observed a 3-fold improvement in fidelity relative to Taq polymerase. According to the vendor, AccuPrime-Taq High Fidelity is an enzyme blend that contains Taq polymerase, a processivity-enhancing protein, and a higher fidelity proofreading polymerase from Pyrococcus arter GB-D. The lower error rate seen with AccuPrime-Taq most likely arises from the GB-D polymerase editing mistakes introduced by Taq polymerase as opposed to enhanced processivity since increased processivity has been shown to have no significant effect on base substitution errors [22, 27]. The mutation spectrum of the blend is almost identical to that seen with Taq polymerase alone, with transitions predominant and a significant bias for A•T → G•C changes (71% for AccuPrime-Taq versus 73% for Taq). However, it should be noted that a study on the mutation spectra of GB-D DNA polymerase (commercially available as Deep Vent) found A•T → G•C transitions to be the predominant mutation [28]. Detailed analysis on the contribution of each enzyme to the overall mutation spectrum is also precluded by the proprietary enzyme formulation used by the vendor.

In summary, we have used direct DNA sequencing of cloned PCR products to assay polymerase fidelity and evaluate other aspects of enzyme suitability for large-scale cloning projects. Based on minimizing PCR errors, Pfu polymerase, Pwo polymerase, and Phusion all produce acceptably low levels of mutations. Phusion was observed to produce more indel mutations than Pfu eller Pwo polymerases, although the total number of mutations was limited. This type of mutation is particularly problematic for ORF cloning projects and should be taken into account in the process of enzyme selection. Aside from fidelity considerations, amplification efficiency values were significantly higher for Phusion and Pwo jämfört med Pfu, although further optimization of the PCR reaction for Pfu would likely improve efficiency values. Likewise, for cloning projects where targets are either very long or very highly GC-rich fidelity may be of lesser importance relative to the ability to amplify “difficult” target DNA. And finally, since the application space for PCR technology is huge, with cloning representing only a small fraction, enzymes other than those studied here need to be compared and evaluated based on project-specific needs and challenges.

3. Materials and Methods

3.1. PCR Reactions

All enzymes and reaction buffers were from commercial sources: Fermentas (Taq polymerase), Invitrogen/Life Technologies (AccuPrime-Taq), EMD Chemicals/Novagen (KOD Hot Start), Agilent (cloned Pfu polymerase), Finnzymes (Phusion Hot Start), and Roche (Pwo polymerase). PCR reactions were carried out in a final volume of 50 μL using buffer conditions and enzyme amounts recommended by the vendor. For reactions with Phusion, the GC buffer was used. In all cases, reactions included 0.2 mM each dNTP (Fermentas) and 0.2 mM each primer (IDT) with the sequences (5′ to 3′) GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACC for the forward primer and GGGGACCACTTTGTACAAGAAAGCTGGGTC for the reverse primer. Template for PCR reactions was miniprep plasmid DNA, with each plasmid template containing a unique target sequence of known sequence and size, ranging from 0.3 to 3 kb. The target insert was cloned in between the att sites of a pDONR vector, allowing the use of a common primer set for all plasmids. Each PCR reaction contained 0.025 ng plasmid DNA, quantitated using the PicoGreen DNA quantitation reagent (Invitrogen/Life Technologies), and thus the amount of input target (i) was calculated as

ng (size of target ÷ (size of target + size of plasmid)). The thermocycling protocol for all reactions with target length ≤2 kb was 5 minutes, 95°C, then 30 cycles of 15 seconds, 95°C → 30 seconds, 55°C → 2 minutes, 72°C, and finally 7 minutes at 72°C. For the targets >2 kb in size, the 2-minute extension step was extended to 4 minutes. For analysis of PCR products by gel, 2 μL of each PCR reaction was run on a 2% agarose eGel (Invitrogen/Life Technologies) run according to vendor recommendations.

3.2. Quantitation of PCR Reactions

Efficiency of PCR amplification was determined by measuring the amount of product using a modified PicoGreen dsDNA quantitation assay. This method was facilitated by optimizing the PCR reaction to produce a single product band (Figure 1). Using a Biomek FX-P (Beckman) automated liquid handing system, 5 μL of each PCR reaction was diluted 50-fold in TE buffer (pH 8) into a new 96-well plate. From this plate, 5 μL from each well was mixed with 195 μL of PicoGreen solution, a 500-fold dilution of dye in TE (pH 8). Fluorescence measurements were taken with a Paradigm (Beckman) plate reader. Background fluorescence was determined from a PCR reaction that contained no template DNA. Following background subtraction, DNA concentration was determined by comparing fluorescence readings to those obtained with a standard curve using DNA of known concentration supplied with the dye. Extent of target amplification (e) is calculated as e = (ng DNA after PCR) ÷ (ng of target DNA input), and the number of template doublings during PCR (d) can be calculated as

3.3. Cloning of PCR Products

PCR reactions were purified in 96-well plate format by the addition of PEG 8000 and MgCl2 to final concentrations of 10% and 10 mM, respectively, directly to each well of the PCR plate using a multichannel pipettor. The plate was spun at 4000 rpm for 60 minutes at room temperature, and the supernatant was discarded. Pellets were washed two times with cold isopropanol, air-dried, and resuspended in 25 μL TE (pH 8). This protocol resulted in excellent yields (50–75%) of PCR products, with no products <300 bp, as judged by gel electrophoresis. Purified PCR products were cloned into a pDONR223 vector (a generous gift of Drs. Dominic Esposito and Jim Hartley, NCI, Frederick, MD) using BP Clonase II (Invitrogen/Life Technologies). Clonase reactions were assembled using a multichannel pipettor in 96-well PCR plates in a 5 μL volume and contained 75 ng pDONR223, 1 μL purified PCR product (typically 50–150 ng DNA), and 1 μL BP Clonase II. Sealed plates were incubated at least 16 hours at 25°C, and 1 μL of each reaction was immediately (no proteinase K treatment) used to transform either 25 μL or 50 μL of competent TOP10 cells (Invitrogen/Life Technologies). Following heat shock and recovery, following addition of 250 μL of SOC media, 100 μL of cells was plated on LB plates containing 50 mg/mL spectinomycin. Equivalent numbers of colonies were observed in transformations using 25 μL or 50 μL of frozen competent cells, and control BP reactions lacking BP Clonase II or PCR product resulted in no transformants.

3.4. Screening of Transformants

Three colonies from each transformation plate were picked and cultured in 96-well plates (Costar 3788) sealed with gas-permeable membrane, with each colony incubated in 150 mL of LB media with 50 mg/mL spectinomycin and 10% glycerol. After overnight incubation at 37°C (no shaking), 1 μL of each culture was used to screen by colony PCR for the presence of insert with expected size. Colony PCR reactions (25 mL) used the same primers used for cloning at a final concentration of 0.1 mM each, with 30 amplification cycles as described above, with GoTaq polymerase (Promega). Reactions were analyzed by agarose gel electrophoresis, and the presence of a band at or near the expected size was scored as a “hit.” The number of hits (0–3) for each target was determined, and an average number of hits per target for each plate were determined and used as a measure of Clonase reaction efficiency.

3.5. Clone Sequencing

In cases where Clonase efficiency values were >66%, average of at least 2 hits out of 3 colonies screened, the entire liquid culture plate was replicated with a 96-pin replicator onto an agar plate with the same dimensions as a 96-well plate. The plate was immediately submitted to an outside vendor (Quintarabio, Berkeley, CA), and after growth overnight sequencing was performed on amplified DNA from each clone. If Clonase efficiency values were <66% (Taq och Pfu polymerase reactions), a rearray step was added, using a Qpix2 colony picking robot (Genetix) to maximize the number of clones with correct-size insert on one plate. For comparing sequencing results using cells versus miniprep DNA, one plate of colonies picked from a Taq cloning reaction was replicated into a 96-well deep well plate with 800 mL media per well and grown overnight with shaking at 300 rpm. Cells were pelleted, and DNA was prepared using a Qiaprep 96 Turbo Miniprep Kit (Qiagen). Eluted DNA was submitted directly for sequencing.

Intressekonflikt

Författarna förklarar att det inte finns någon intressekonflikt när det gäller publiceringen av denna artikel.

Erkännanden

This work was part of the DOE Joint BioEnergy Institute (http://www.jbei.org) supported by the U.S. Department of Energy, Office of Science, Office of Biological and Environmental Research, through Contract DE-AC02-05CH11231 between Lawrence Berkeley National Laboratory and the U.S. Department of Energy. The authors would like to thank Drs. Dominic Esposito and Jim Hartley (NCI, Frederick, MD) for the gift of pDONR223 DNA, Huu M. Tran (JBEI/Sandia National Laboratories) for assistance with the laboratory automation, Drs. Richard Shan and Sue Zhao (Quintara Biosciences, Berkeley, CA) for DNA sequencing and analysis, and Dr. Nathan J. Hillson for critical reading of the paper.

Referenser

  1. B. G. Fox, C. Goulding, M. G. Malkowski, L. Stewart, and A. Deacon, “Structural genomics: from genes to structures with valuable materials and many questions in between,” Naturmetodervol. 5, nr. 2, pp. 129–132, 2008. View at: Publisher Site | Google Scholar
  2. A. Rolfs, W. R. Montor, S. Y. Sang et al., “Production and sequence validation of a complete full length ORF collection for the pathogenic bacterium Vibrio cholerae,” Proceedings of the National Academy of Sciences of the United States of Americavol. 105, no. 11, pp. 4364–4369, 2008. View at: Publisher Site | Google Scholar
  3. G. Temple, P. Lamesch, S. Milstein et al., “From genome to proteome: developing expression clone resources for the human genome,” Human Molecular Geneticsvol. 15, nr. 1, pp. R31–R43, 2006. View at: Publisher Site | Google Scholar
  4. J. Cline, J. C. Braman, and H. H. Hogrefe, “PCR fidelity of Pfu DNA polymerase and other thermostable DNA polymerases,” Nukleinsyraforskningvol. 24, nr. 18, pp. 3546–3551, 1996. View at: Publisher Site | Google Scholar
  5. A. M. Dunning, P. Talmud, and S. E. Humphries, “Errors in the polymerase chain reaction,” Nukleinsyraforskningvol. 16, nr. 21, p. 10393, 1988. View at: Publisher Site | Google Scholar
  6. R. K. Saiki, D. H. Gelfand, S. Stoffel et al., “Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase,” Vetenskapvol. 239, no. 4839, pp. 487–491, 1988. View at: Publisher Site | Google Scholar
  7. K. R. Tindall and T. A. Kunkel, “Fidelity of DNA synthesis by the Thermus aquaticus DNA polymerase,” Biokemivol. 27, nr. 16, pp. 6008–6013, 1988. View at: Publisher Site | Google Scholar
  8. J. M. Flaman, T. Frebourg, V. Moreau et al., “A rapid PCR fidelity assay,” Nukleinsyraforskningvol. 22, nr. 15, pp. 3259–3260, 1994. View at: Publisher Site | Google Scholar
  9. P. Keohavong and W. G. Thilly, “Fidelity of DNA polymerases in DNA amplification,” Proceedings of the National Academy of Sciences of the United States of Americavol. 86, nr. 23, pp. 9253–9257, 1989. View at: Publisher Site | Google Scholar
  10. P. André, A. Kim, K. Khrapko, and W. G. Thilly, “Fidelity and mutational spectrum of Pfu DNA polymerase on a human mitochondrial DNA sequence,” Genomforskningvol. 7, nr. 8, pp. 843–852, 1997. View at: Google Scholar
  11. G. S. Provost, P. L. Kretz, R. T. Hamner et al., “Transgenic systems for in vivo mutations analysis,” Mutation Research-Fundamental and Molecular Mechanisms of Mutagenesisvol. 288, no. 1, pp. 133–149, 1993. View at: Publisher Site | Google Scholar
  12. T. A. Kunkel and K. Bebenek, “DNA replication fidelity,” Annual Review of Biochemistryvol. 69, pp. 497–529, 2000. View at: Publisher Site | Google Scholar
  13. M. Takagi, M. Nishioka, H. Kakihara et al., “Characterization of DNA polymerase from Pyrococcus sp. strain KOD1 and its application to PCR,” Tillämpad och miljömikrobiologivol. 63, no. 11, pp. 4504–4510, 1997. View at: Google Scholar
  14. M. Kitabayashi, Y. Nishiya, M. Esaka, M. Itakura, and T. Imanaka, “Gene cloning and polymerase chain reaction with proliferating cell nuclear antigen from Thermococcus kodakaraensis KOD1,” Bioscience, Biotechnology and Biochemistryvol. 66, nr. 10, pp. 2194–2200, 2002. View at: Publisher Site | Google Scholar
  15. K. S. Lundberg, D. D. Shoemaker, M. W. W. Adams, J. M. Short, J. A. Sorge, and E. J. Mathur, “High-fidelity amplification using a thermostable DNA polymerase isolated from Pyrococcus furiosus,” Genvol. 108, nr. 1, pp. 1–6, 1991. View at: Publisher Site | Google Scholar
  16. M. Li, F. Diehl, D. Dressman, B. Vogelstein, and K. W. Kinzler, “BEAMing up for detection and quantification of rare sequence variants,” Naturmetodervol. 3, nr. 2, pp. 95–97, 2006. View at: Publisher Site | Google Scholar
  17. G. Marsischky and J. LaBaer, “Many paths to many clones: a comparative look at high-throughput cloning methods,” Genomforskningvol. 14, nr. 10, pp. 2020–2028, 2004. View at: Publisher Site | Google Scholar
  18. J. T. Lis, “Fractionation of DNA fragments by polyethylene glycol induced precipitation,” Methods in Enzymologyvol. 65, nr. 1, pp. 347–353, 1980. View at: Publisher Site | Google Scholar
  19. J. J. Choi, J. Song, H. N. Ki et al., “Unique substrate spectrum and PCR application of Nanoarchaeum equitans family B DNA polymerase,” Tillämpad och miljömikrobiologivol. 74, nr. 21, pp. 6563–6569, 2008. View at: Publisher Site | Google Scholar
  20. L. L. Ling, P. Keohavong, C. Dias, and W. G. Thilly, “Optimization of the polymerase chain reaction with regard to fidelity: modified T7, Taq, and vent DNA polymerases,” PCR Methods and Applicationsvol. 1, nr. 1, pp. 63–69, 1991. View at: Publisher Site | Google Scholar
  21. K. A. Eckert and T. A. Kunkel, “High fidelity DNA synthesis by the Thermus aquaticus DNA polymerase,” Nukleinsyraforskningvol. 18, nr. 13, pp. 3739–3744, 1990. View at: Publisher Site | Google Scholar
  22. J. F. Davidson, R. Fox, D. D. Harris, S. Lyons-Abbott, and L. A. Loeb, “Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase,” Nukleinsyraforskningvol. 31, nr. 16, pp. 4702–4709, 2003. View at: Publisher Site | Google Scholar
  23. E. Viguera, D. Canceill, and S. D. Ehrlich, “Replication slippage involves DNA polymerase pausing and dissociation,” EMBO Journalvol. 20, nej. 10, pp. 2587–2595, 2001. View at: Publisher Site | Google Scholar
  24. K. Khrapko, H. Coller, P. André et al., “Mutational spectrometry without phenotypic selection: human mitochondrial DNA,” Nukleinsyraforskningvol. 25, nr. 4, pp. 685–693, 1997. View at: Publisher Site | Google Scholar
  25. A. Niimi, S. Limsirichaikul, S. Yoshida et al., “Palm mutants in DNA polymerases α och η Alter DNA replication fidelity and translesion activity,” Molekylär och cellulär biologivol. 24, nr. 7, pp. 2734–2746, 2004. View at: Publisher Site | Google Scholar
  26. E. M. Kennedy, C. Hergott, S. Dewhurst, and B. Kim, “The mechanistic architecture of thermostable Pyrococcus furiosus family B DNA polymerase motif A and its interaction with the dNTP substrate,” Biokemivol. 48, nr. 47, pp. 11161–11168, 2009. View at: Publisher Site | Google Scholar
  27. T. A. Kunkel, S. S. Patel, and K. A. Johnson, “Error-prone replication of repeated DNA sequences by T7 DNA polymerase in the absence of its processivity subunit,” Proceedings of the National Academy of Sciences of the United States of Americavol. 91, no. 15, pp. 6830–6834, 1994. View at: Publisher Site | Google Scholar
  28. H. Huang and P. Keohavong, “Fidelity and predominant mutations produced by deep vent wild-type and exonuclease-deficient DNA polymerases during in vitro DNA amplification,” DNA and Cell Biologyvol. 15, nr. 7, pp. 589–594, 1996. View at: Publisher Site | Google Scholar

Upphovsrätt

Copyright © 2014 Peter McInerney et al. Detta är en artikel med öppen tillgång som distribueras under Creative Commons Attribution License, som tillåter obegränsad användning, distribution och reproduktion i vilket medium som helst, förutsatt att originalverket är korrekt citerat.


How is Taq polymerase produced? - Biologi

Taq polymeras is a thermostable DNA polymeras named after the thermophilic bacterium Thermus aquaticus from which it was originally isolated by Thomas D. Brock in 1965 . It is often abbreviated to "Taq Pol", and is frequently used in polymeras chain reaction (PCR).
Hela artikeln >>>

Vad är Taq polymeras? Taq polymeras is a DNA polymeras (enzyme) isolated from the heat-tolerant bacterium Thermus aquaticus
Hela artikeln >>>

Taq DNA Polymerase is the most common polymeras used for PCR reactions. . Applications: Taq DNA Polymerase can be used in most applications including the .
Hela artikeln >>>

<em>Taq</em> DNA Polymerase is a thermostable DNA polymeras that possesses a 5' . När ska Taq DNA Polymerase be used in a primer extension reaction or for PCR? .
Hela artikeln >>>

<I>Taq</I> DNA Polymerase is a thermostable DNA polymeras that possesses a 5' . När ska Taq DNA Polymerase be used in a primer extension reaction or for PCR? .
Hela artikeln >>>

High quality,Recombinant Taq DNA Polymerase:EUR0.01/Unit!Order your free sample today!Bulk order,please contact us.Email:[email protected] .org.cn
Hela artikeln >>>

Fastest to activate chemically modified hot start Taq DNA polymeras. . 5-6 - Taq DNA Polymerase (temperature-dependent inhibitor), Vendor B .
Hela artikeln >>>

Taq DNA Polymerase has no detectable 3'=>5' exonuclease (proofreading) activity . The error rate of Taq DNA Polymerase in PCR is 2.2x10-5 errors per nt per cycle, .
Hela artikeln >>>

Taq Polymerase. GENTAUR EUROPE +32 1658 9045 +32 1650 9045. BELGIUM. tel +32 2 732 5688 . Very robust Taq DNA Polymerase. 500u. BIO-21040. 93 Euro. BIOTAQ .
Hela artikeln >>>

Taq polymeras summary with 3 pages of encyclopedia entries, essays, summaries, research information, and more. . Taq Polymerase : Forensic Science Terms. 35 .
Hela artikeln >>>

Taq polymeras. Different concentrations of a Taq polymeras were tested using primer mixture C . Five native Taq polymerases, from five different sources, .
Hela artikeln >>>

Detection of viral RNA by polymeras chain reaction (PCR) requires the prior . of this phenomenon has revealed direct interference of RT with Taq polymeras. .
Hela artikeln >>>

. a broad range of pcr reagents,including taq polymeras, PCR master mix, dNTPs, High-Stability PCR . Our best-sell Taq DNA Polymerase offers your cost .
Hela artikeln >>>

JNetDirect Biosciences - Biotechnology software, equipment and supplies distributor. . Taq DNA Polymerase. TthPlus DNA Polymerase. anti-Taq Monoclonal .
Hela artikeln >>>

Generally, standard Taq DNA Polymerase has difficulty amplifying targets >5 kb. . general guidelines for primers to be used with Takara's Ex TaqPolymerase? .
Hela artikeln >>>

Britannica online encyclopedia article on taq polymeras (enzyme), . replenished after every cycle because it is not stable at the high temperatures needed for .
Hela artikeln >>>

Taq polymeras. From Molecular Biology Wiki. Jump to:navigation, search. Taq polymeras is a thermostable DNA polymeras named after the thermophilic .
Hela artikeln >>>

PCR reagents from Bionexus include DNA amplification kits, DNA polymerases, and PCR Premixes to . Modified Taq polymeras activates at high .
Hela artikeln >>>


Future Directions

Many properties affect the efficacy and utility of a PCR polymerase. Polymerase active site architecture and proofreading activity affect the accuracy of the final product. Polymerase blends and fusion to a DNA binding protein confer superior PCR performance for amplicon length and, in the case of the chimera, reaction speed. Other important advances in PCR, such as hot-start polymerases to increase reaction specificity, multiplex PCR (Figure 5) and qPCR have also revolutionized the life sciences.

As demonstrated by engineered blends and chimeras, properties of the polymerase itself can be modulated to improve PCR performance. In the future, it is likely that polymerase properties will increasingly be tailored to specific PCR applications, and as such, this is an important area of research at NEB.

Figure 5: The Multiplex PCR 5X Master Mix includes Taq DNA Polymerase and buffer that has been optimized for amplification of multiple targets. Its performance is illustrated in a 15-plex reaction with various amounts of human genomic DNA as template (shown below gel).


Titta på videon: Taq Polimerasa (Juli 2022).


Kommentarer:

  1. Dasida

    Inte ett dåligt inlägg, men mycket för mycket.

  2. Terika

    Som specialist kan jag hjälpa till.

  3. Akijin

    Det verkar för mig, du har fel



Skriv ett meddelande