Information

AntiTrypsin enzym

AntiTrypsin enzym



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Är lungan översmält hos en rökande patient på grund av en kombination av rökning och en defekt i antitrypsingenen (förhindrar matsmältning från proteas)? Eller fungerar rökning på samma sätt som en patient med en defekt i genen?


Wikipedia har en fin artikel om sjukdomen.

https://en.wikipedia.org/wiki/Alpha_1-antitrypsin_deficiency

från den artikeln

Alfa-1 antitrypsin (A1AT) produceras i levern, och en av dess funktioner är att skydda lungorna från neutrofil elastas, ett enzym som kan störa bindväv.

Neutrofila proteaser är aktiva överallt där neutrofiler finns. Människor som inte röker kan få KOL bara av att ha den dubbla recessiva formen av denna sjukdom (ingen aktiv alfa-1-antitrypsin). Men om det är fallet med dig och du också röker får du accelererad KOL. KOL är redan en inflammatorisk sjukdom förknippad med slem- och neutrofilverkan och skadan som detta orsakar är utan tvekan förstärkt med avsaknaden av skyddande alfa-1-antitrypsin.

Om du lider av detta tillstånd kan du få infusioner av alfa-1-antitrypsin - ungefär som typ 1-diabetiker får insulin.


1.18: Enzymfunktion

  • Bidraget av CK-12: Biology Concepts
  • Kommer från CK-12 Foundation

Har celler ett enzym med många funktioner, eller många enzymer, var och en med bara en funktion?

Enzymer. Magiska proteiner nödvändiga för livet. Så hur fungerar enzymer? Hur katalyserar de bara en specifik biokemisk reaktion? I ett pussel kommer bara två bitar att passa ihop ordentligt. Att förstå det är ett av huvudstegen för att förstå hur enzymer fungerar.


Orsaker

Mutationer i SERPINA1 genen orsakar alfa-1 antitrypsinbrist. Denna gen ger instruktioner för att göra ett protein som kallas alfa-1 antitrypsin, som skyddar kroppen från ett kraftfullt enzym som kallas neutrofil elastas. Neutrofilt elastas frigörs från vita blodkroppar för att bekämpa infektion, men det kan attackera normala vävnader (särskilt lungorna) om det inte kontrolleras hårt av alfa-1-antitrypsin.

Mutationer i SERPINA1 genen kan leda till brist (brist) på alfa-1-antitrypsin eller en onormal form av proteinet som inte kan kontrollera neutrofil elastas. Utan tillräckligt med funktionellt alfa-1-antitrypsin förstör neutrofilt elastas alveolerna och orsakar lungsjukdomar. Onormalt alfa-1-antitrypsin kan också ackumuleras i levern och skada detta organ.

Miljöfaktorer, såsom exponering för tobaksrök, kemikalier och damm, påverkar sannolikt svårighetsgraden av alfa-1-antitrypsinbrist.

Lär dig mer om genen associerad med Alpha-1 antitrypsinbrist


Behandling Behandling

I allmänhet inkluderar behandlingen av medicinska problem förknippade med alfa-1-antitrypsinbrist (AATD) de vanliga medicinska terapierna och stödjande vård för det specifika medicinska problemet. Det finns dock en speciell terapi tillgänglig för vissa personer med AATD som har lungproblem som kallas augmentationsterapi (ibland kallad ersättningsterapi). [2] [3] [5]

Förstärkningsterapi syftar till att öka blodnivån av alfa-1 antitrypsinprotein (AAT) genom att tillsätta renad, human AAT direkt i personens blod genom intravenös (IV) infusion. Målet är att förhindra utvecklingen av lungsjukdom. Hudproblem brukar också bli bättre. Augmentationsterapi påverkar inte leversjukdom associerad med AATD. [2] [3] [5]


Enzymer i aktion- Kvantifiera mjölkproteiner

Trypsin är ett enzym som hydrolyserar proteiner till peptider, redo för andra enzymer att skära dem längre ner till sina aminosyror för användning i kroppen. Enzymer är katalysatorer, vilket innebär att de hjälper eller orsakar en reaktion utan att de själva förbrukas. Trypsin verkar i tunntarmen, efter att syra och pepsin i magen har påbörjat arbetet med att bryta ner proteinerna.

Detta experiment använder mjölk som innehåller proteinet kasein. När kaseinet i mjölk bryts ned blir de mindre molekylerna lösliga, vilket minskar vätskans opacitet. Tiden det tar att bryta ner molekylerna kan mätas och jämförelse av kända värden mot okända värden gör det möjligt att beräkna de okända. Eftersom mjölken inte blir helt klar på grund av den oundvikliga förekomsten av fett, kommer vissa fel att införas genom olika beslut av endpoint, inte bara bland klassen utan varje elev kan ha sina egna inkonsekvenser. En kolorimeter i transmittansläge kan istället användas för att minska denna typ av fel, men den visuella bedömningen bör vara tillräcklig för att visa grundprincipen. Detta experiment börjar med kända koncentrationer av skummjölkspulver. Koncentrationen av själva proteinet kan beräknas om du vill, utifrån informationen på mjölkpaketet som vi har funnit att skummjölk i allmänhet innehåller cirka 9g protein per 25g pulver (36%).

FÖRBEREDELSER: LABETEKNIKER

  1. Lös upp 30 g mjölkpulver i 250 ml destillerat vatten (dH2O)
  2. Tillsätt destillerat vatten för att göra 300 ml för en 10 % stamlösning. (Justera efter din klassstorlek &ndash 300 ml lager bör räcka för 12 grupper med hänsyn till spill). Späd ut enligt följande:
        • 5 % standard &ndash 75 ml lager i 75 ml dH2O
        • 4 % standard &ndash 60 ml lager i 90 ml dH2O
        • 3 % standard &ndash 45 ml lager i 105 ml dH2O
        • 2 % standard &ndash 30mL lager i 120mL dH2O
        • 1 % standard &ndash 15 ml lager i 135 ml dH2O
        1. Använd den återstående mjölken för att skapa två okända prover (X och Y) inom intervallet 1-5 %, t.ex. 47 ml lager i 103 ml dH2O och 28 ml lager i 122 ml dH2O. Håll koll på koncentrationen men avslöja inte för eleverna.

        Trypsin stamlösning:

        1. Lös 1 g trypsin i 100 ml dH2O för att göra en 1% lösning.
        2. Kör en snabb analys (se metod nedan) för att säkerställa att 5% proteinstandarden tar cirka 2-3 minuter till slutpunkten.
        3. Om tidpunkten är lämplig, lös upp 4g trypsin i 400mL dH2O för att göra resten av din 1% lösning. Om det går för snabbt eller för långsamt, justera utspädningen på lämpligt sätt.

        METOD: STUDENTAKTIVITET

        1. Märk dina provrör 1 %, 2 %, 3 %, 4 %, 5 %, X och Y.
        2. Tillsätt 10mL av lämplig mjölklösning till varje rör.
        3. Markera ett svart kors, ungefär lika stor som diametern på dina provrör, på det vita papperet.
        4. Till det första röret (1%) tillsätt 5 ml trypsinlösning. Starta timern och skaka försiktigt för att blanda. Om du har handskar på dig kanske du föredrar att hålla tummen över toppen av tuben och blanda genom att vända på tuben, var noga med att du har täckt toppen helt.
        5. Håll krysset bakom provröret och notera hur lång tid det tar för det att bli precis synligt.
        6. Upprepa med de återstående rören &ndash håll konsekvent den punkt där du bestämmer att korset ska vara synligt.
        7. Rita dina resultat för standarderna på ditt millimeterpapper för att lättare kontrollera avvikelser. Om något resultat verkar malplacerat och du behöver köra den standarden igen, är det bäst att använda rena provrör eftersom enzymet kan vara svårt att rensa ut. Om du behöver återanvända en tub, placera först 5 ml trypsin och starta din timer från det att du tillsätter mjölken.
        8. När du är nöjd med att din kalibreringskurva är vettig, rita resultaten för dina två okända för att uppskatta koncentrationen av mjölk i varje.
        9. Klassresultaten ska sammanställas och medelvärdesbildas för att göra en aggregerad kalibreringskurva och uppskattning. Tänk på vad du förväntar dig att se från sammanlagda resultat jämfört med individuella.

        OBSERVATIONER OCH RESULTAT

        Nedan är ett exempel på förväntade resultat. Det är endast en vägledning eftersom individuella resultat kommer att variera.


        Semikvantifiering av monomer och polymer alfa-1-antitrypsin genom centrifugalseparation och analys genom Western blott av lösliga och olösliga komponenter

        Brist på alfa-1-antitrypsin (a1AT), i sin klassiska form, är en autosomal recessiv sjukdom associerad med en ökad risk för leversjukdom hos vuxna och barn, och med lungsjukdom hos vuxna. De allra flesta leversjukdomar är förknippade med homozygositet för Z-mutantallelen, även kallad PiZZ. Denna homozygota allel syntetiserar stora mängder a1AT-mutant Z-protein i levern, men det mutanta proteinet viker sig också felaktigt under biogenes. Som ett resultat hålls ungefär 85 % av molekylerna kvar i hepatocyterna istället för att utsöndras på lämpligt sätt. Den resulterande låga eller "bristiga" serumnivån gör lungorna sårbara för inflammatoriska skador från ohämmade neutrofila proteaser. Det mesta av det mutanta Z-proteinet som kvarhålls i hepatocyter riktas in i intracellulära proteolysvägar, men vissa molekyler förblir i det endoplasmatiska retikulumet under långa tidsperioder och andra antar en ovanlig aggregerad eller "polymeriserad" konformation. Man tror att dessa intracellulära polymerer utlöser en kaskad av intracellulär skada som kan leda till leverskada i slutorganen inklusive kronisk hepatit, cirros och hepatocellulärt karcinom. Det är allmänt accepterat att den sjukdomsorsakande faktorn i mutant Z-alfa-1-antitrypsinbrist (AATD-Z) är den toxiska uppbyggnaden av det mutanta Z-proteinet. Eftersom felveckning av en del men inte allt av Z-proteinet under dess mognad leder till homopolymerisation, skulle en analys för att bedöma mängden normalt veckad ATZ och ackumulerad polymer ATZ vara mycket användbar. Här beskriver vi en metod för att semikvantitativt bedöma dessa två fraktioner i en vävnads- eller cellodlingskälla.

        Nyckelord: AAT ATZ Aggregation Alpha-1 antitrypsin Levercirros Leversjukdom Monomer–polymer Polymerisation Lösligt/olösligt proteinseparation Lagringssjukdom Z-mutant.


        Vilka är symptomen på AATD?

        Alfa-1 antitrypsinbrist (AATD) kan uppträda som lungsjukdom hos vuxna och kan associeras med leversjukdom hos en liten del av drabbade barn. Hos drabbade vuxna är de första symtomen på AATD andnöd med mild aktivitet, nedsatt träningsförmåga och väsande andning. Dessa symtom uppträder vanligtvis mellan 20 och 40 års ålder. Andra tecken och symtom kan vara upprepade luftvägsinfektioner, trötthet, snabba hjärtslag när man står upp, synproblem och oavsiktlig viktminskning.

        Vissa individer med AATD har avancerad lungsjukdom och har emfysem, där de små luftsäckarna (alveolerna) i lungorna skadas. Symtom på emfysem inkluderar andningssvårigheter, en hackande hosta och en tunnformad bröstkorg. Rökning eller exponering för tobaksrök ökar uppkomsten av symtom och skador på lungorna. Andra vanliga diagnoser är KOL (kronisk obstruktiv lungsjukdom), astma, kronisk bronkit och bronkiektasi - ett kroniskt inflammatoriskt eller degenerativt tillstånd i en eller flera bronkier eller bronkioler.

        Leversjukdom, som kallas cirros i levern, är ett annat symptom på AATD. Det kan finnas hos vissa drabbade barn, cirka 10 procent, och har även rapporterats hos 15 procent av vuxna med AATD. I dess sena stadier kan tecken och symtom på leversjukdom inkludera en svullen buk, upphostning av blod, svullna fötter eller ben och gulfärgning av huden och ögonvitorna (gulsot).

        I sällsynta fall kan AATD orsaka en hudsjukdom som kallas pannikulit, som kännetecknas av härdad hud med smärtsamma klumpar eller fläckar. Pannikulit varierar i svårighetsgrad och kan uppstå i alla åldrar.

        Alfa-1-antitrypsinbrist (AATD) kan uppträda som lungsjukdom hos vuxna och kan associeras med leversjukdom hos en liten del av drabbade barn. Hos drabbade vuxna är de första symtomen på AATD andnöd med mild aktivitet, nedsatt träningsförmåga och väsande andning. Dessa symtom uppträder vanligtvis mellan 20 och 40 års ålder. Andra tecken och symtom kan vara upprepade luftvägsinfektioner, trötthet, snabba hjärtslag när man står upp, synproblem och oavsiktlig viktminskning.

        Vissa individer med AATD har avancerad lungsjukdom och har emfysem, där de små luftsäckarna (alveolerna) i lungorna skadas. Symtom på emfysem inkluderar andningssvårigheter, en hackande hosta och en tunnformad bröstkorg. Rökning eller exponering för tobaksrök ökar uppkomsten av symtom och skador på lungorna. Andra vanliga diagnoser är KOL (kronisk obstruktiv lungsjukdom), astma, kronisk bronkit och bronkiektasi - ett kroniskt inflammatoriskt eller degenerativt tillstånd i en eller flera bronkier eller bronkioler.

        Leversjukdom, som kallas cirros i levern, är ett annat symptom på AATD. Det kan finnas hos vissa drabbade barn, cirka 10 procent, och har även rapporterats hos 15 procent av vuxna med AATD. I dess sena stadier kan tecken och symtom på leversjukdom inkludera en svullen buk, upphostning av blod, svullna fötter eller ben och gulfärgning av huden och ögonvitorna (gulsot).

        I sällsynta fall kan AATD orsaka en hudsjukdom som kallas pannikulit, som kännetecknas av härdad hud med smärtsamma klumpar eller fläckar. Pannikulit varierar i svårighetsgrad och kan uppstå i alla åldrar.


        Enzymer: Betydelse, mekanism, klassificering, faktorer och betydelse

        Låt oss göra en fördjupad studie av enzymerna. Efter att ha läst den här artikeln kommer du att lära dig om: 1. Betydelsen av enzymer 2. Klassificering av enzymer 3. Mekanism för enzymverkan 4. Faktorer som påverkar enzymverkan 5. Enzymspecificitet 6. Enzyminhibering och 7. Diagnostisk betydelse av enzymer.

        Betydelsen av enzymer:

        Enzymer är proteinhaltiga (och till och med nukleinsyror) biokatalysatorer som förändrar (generellt ökar) reaktionshastigheten.

        Fri energi för aktivering och effekt av katalys:

        En kemisk reaktion som substrat till produkt kommer att äga rum när ett visst antal substratmolekyler vid varje ögonblick har tillräckligt med energi för att uppnå ett aktiverat tillstånd som kallas “transition state” där sannolikheten för att skapa eller bryta en kemisk bindning till från produkten är mycket hög. “Fri aktiveringsenergi” är mängden energi som krävs för att föra alla molekylerna i en grammol av ett substrat vid en given temperatur till övergångstillståndet.

        I närvaro av en katalysator kombineras substratet med det för att producera ett transient tillstånd med en lägre aktiveringsenergi än den för substratet enbart. Detta påskyndar reaktionen. När produkten väl har bildats är enzymet (katalysatorn) fritt att kombinera med en annan molekyl av substratet och upprepa processen. Även om det finns en förändring i den fria energin för aktivering i närvaro av ett enzym, förblir den totala fria energiförändringen av reaktionen densamma oavsett om reaktionen katalyseras av ett enzym eller inte.

        Klassificering av enzymer:

        Klassificering av enzymer baseras på:

        (2) närvaro eller frånvaro vid en given tidpunkt,

        (3) Regleringen av handling,

        (4) Platsen för handling och

        (5) Deras kliniska betydelse.

        1. Klassificering baserad på den katalyserade reaktionen:

        Enzymer är grovt indelade i sex grupper baserat på vilken typ av reaktion som katalyseras.

        (a) Oxidoreduktaser:

        Enzymer som orsakar oxidations- och reduktionsreaktioner.

        Ex. Pyruvat + NADH—laktatdehydrogenas → Laktat + NAD+

        Glutaminsyra + NAD—glutamatdehydrogenas → α-ketoglutarat + NH3 + NADH

        Enzymer som katalyserar överföring av grupper från ett substrat till ett annat, annat än väte. Ex. Transaminas katalyserar överföring av aminogrupper från aminosyra till en ketosyra för att bilda en ny ketosyra och en ny aminosyra.

        Ex. (α-Ketoglutarat + Alanin—alaninaminotransferas → Glutamat + Pyruvat

        Aspartat + α-Ketoglutarat - aspartataminotransferas Oxaloacetat + Glutamat

        De enzymer som katalyserar brytningen av bindningar med tillsats av vatten (hydrolys). Alla matsmältningsenzymer är hydrolaser. Ex. Pepsin, trypsin, amylas, maltas.

        De enzymer som katalyserar nedbrytningen av en förening till två ämnen genom annan mekanism än tillsats av vatten. Den resulterande produkten har alltid en dubbelbindning.

        Ex. Fruktos-1-6-difosfat—ALDOLAS → Glyceraldehyd-3-fosfat + DHAP

        De enzymer som katalyserar inter-omvandlingen av optiska och geometriska isomerer.

        Ex. Glyceraldehyd-3-fosfat—ISOMERAS → Dihydroxiacetonfosfat

        Dessa enzymer katalyserar föreningen av två föreningar. Detta är alltid en energikrävande process (aktiv process).

        Ex. Pyruvat + CO2 + ATP—pyruvatkarboxylas Oxaloacetat + ADP + Pi

        2. Klassificering baserat på närvaro eller frånvaro vid en given tidpunkt:

        Två typer identifieras:

        (a) Inducerbara enzymer:

        De enzymer som syntetiseras av cellen närhelst de behövs. Syntes av dessa enzymer kräver vanligtvis en inducerare.

        Ex. Invertas, HMG-CoA-reduktas, p-galaktosidas och enzymer involverade i ureacykeln.

        (b) Konstitutiva enzymer:

        Enzymer som ständigt finns i normala mängder i kroppen, oavsett inducerare.

        3. Klassificering baserad på regleringen av enzymverkan:

        De är av två typer:

        (a) Regulatoriska enzymer:

        Verkan av dessa enzymer regleras beroende på cellens status. Verkan av regulatoriska enzymer antingen ökas eller minskas av en modulator på ett annat ställe än det aktiva stället som kallas “allosteriska stället”.

        Ex. Fosfofruktokinas (PFK) och glutamatdehydrogenas.

        (b) Icke-regulatoriska enzymer:

        Verkan av dessa enzymer är inte reglerad.

        Ex. Succinatdehydrogenas.

        4. Klassificering baserat på platsen för åtgärden:

        Beroende på de två handlingsplatserna är de uppdelade i:

        (a) Intracellulära enzymer:

        Enzymer som produceras av cellen och verkar inuti samma cell kallas intracellulära enzymer.

        Ex. Alla enzymer i glykolysen och TCA-cykeln.

        (b) Extracellulära enzymer:

        Enzymer som produceras av en cell men verkar utanför den cellen oberoende av den. Ex, Alla matsmältningsenzymer, dvs. trypsin, pankreaslipas etc.

        5. Klassificering baserat på deras kliniska betydelse:

        (a) Funktionella plasmaenzymer:

        Enzymer som finns i plasman i avsevärt hög koncentration och är funktionella i plasman på grund av närvaron av deras substrat, plasma.

        Ex. Serumlipas, blodkoagulerande enzymer.

        (b) Icke-funktionella plasmaenzymer:

        Enzymer finns i plasma i försumbar koncentration och har ingen funktion i plasman på grund av frånvaron av deras substrat i det. Icke-funktionella plasmaenzymer är av diagnostisk betydelse.

        Enzymer namnges med fyra siffror av enzymnomenklaturkommissionen, varvid

        1:a siffran hänvisar till huvudklassificeringen

        2:a siffran avser underklassificering

        3:e siffran hänvisar till sub-sub-klassificering

        4:e siffran hänvisar till det specifika enzymet

        Ex. 2.7.3.2 är adenosintrifosfat-kreatinfosfotransferas (kreatinkinas).

        Mekanism för enzymverkan:

        Ett enzym (eller protein) bör vara i sin naturliga konformation för att vara biologiskt aktivt. Den tredimensionella konformationen av enzymer har ett speciellt ställe där substratet binder och påverkas, detta ställe kallas det aktiva stället.

        Den aktiva webbplatsen är öronmärkt till två specifika områden:

        (1) Bindningsställe—där substratet binder och

        (2) Katalytiskt ställe – där enzymkatalysen äger rum.

        Aminosyrorna som finns på det aktiva stället är tyrosin, histidin, cystein, glutaminsyra, asparaginsyra, lysin och serin. I aldolas finns lysin på det aktiva stället. I karboxipeptidas finns två tyrosinrester på det aktiva stället. Ribonukleas har två histidiner på det aktiva stället. Michaelis och Menten etablerade teorin om kombination av enzym med substrat för att bilda enzym-substratkomplexet. Enligt detta kombineras enzymet med substratet på vilket det verkar för att bilda ett enzym-substratkomplex. Sedan frigörs detta enzym och substratet bryts ner till reaktionsprodukten.

        E [Enzym] + S [Substrat] → ES [Enzym-Substrate komplex] → E + Produkt

        ES-komplexet kallas också ‘Michaelis Menten-komplexet’.

        Enzymer påskyndar den kemiska reaktionshastigheten genom fyra huvudmekanismer, nämligen.

        1. Närhet och orientering:

        Enzymet binder till substratet på ett sådant sätt att den mottagliga bindningen är i omedelbar närhet av den katalytiska gruppen och även exakt orienterad mot den vilket resulterar i katalysen.

        2. Strain and Distortion eller Induced Fit Model:

        Bindning av substratet inducerar en konformationsförändring i enzymmolekylen som spänner formen på det aktiva stället och även förvränger det avgränsade substratet, vilket leder till katalys. Bindningen av substratet till enzymet kommer att åstadkomma en förändring i den tertiära eller kvartära strukturen hos enzymmolekylen, vilket destabiliserar enzymet. För att uppnå stabilitet förvränger enzymet substratet och bildar därigenom reaktionsprodukten.

        3. Allmän syra-baskatalys:

        Det aktiva stället för enzymet har aminosyror som är bra protondonatorer eller protonacceptorer, vilket resulterar i syra-baskatalys av substratet.

        4. Kovalent katalys:

        Vissa enzymer reagerar med sina substrat för att bilda mycket instabila, kovalent sammanfogade enzym-substratkomplex, som genomgår ytterligare reaktion för att bilda produkterna.

        Faktorer som påverkar enzymverkan:

        Faktorerna som påverkar hastigheten för den enzymkatalyserade reaktionen är:

        3. Substratkoncentration

        5. Koncentration av produkter

        1. Effekt av temperatur:

        När alla andra parametrar hålls konstanta (dvs på sin optimala nivå), ökar enzymreaktionshastigheten långsamt med ökningen av temperaturen tills den når ett maximum. Ytterligare temperaturökning denaturerar proteinet vilket resulterar i en minskning av enzymverkan och en ytterligare temperaturökning kan helt förstöra proteinet.

        Temperaturen, vid vilken enzymaktiviteten är maximal, betecknas som den optimala temperaturen. De flesta av enzymerna är helt inaktiva vid 0°C till 4°C, deras aktivitet börjar vid 10°C och ökar sakta och når sin maximala kapacitet vid sin optimala temperatur. Majoriteten av enzymerna i människokroppen har sina optimala temperaturer mellan 37°C och 40°C.

        Utöver denna temperatur blir enzymerna mindre aktiva och kan förlora sin aktivitet helt vid högre temperaturer. Vid feber ökar temperaturen den metaboliska aktiviteten på grund av ökad enzymverkan. Minskad temperatur leder till hypotermi som ses vid organtransplantation och öppen hjärtkirurgi.

        Men det finns liv i mycket kalla områden och även i varma källor, vilket indikerar att samma enzym som finns i mänskliga celler, till exempel enzymerna från glykolysen och TCA-cykeln, har sina optimala temperaturer vid extrema temperaturer.

        Sålunda existerar kylbakterier med den optimala temperaturen för dess enzymer nära 4°C. På samma sätt har bakterier som överlever i varma källor enzymerna med sina optimala temperaturer som närmar sig hundra (s) grader Celsius ex. den optimala temperaturen för Taq-polymeras är 72°C.

        Vant Hoffs koefficient:

        Det är koefficienten som förklarar att för varje temperaturhöjning på 10°C ökar enzymaktiviteten 2 gånger tills den optimala temperaturen uppnås.

        2. Effekt av pH:

        När alla andra parametrar hålls konstanta ökar hastigheten för en enzymkatalyserad reaktion tills den når optimalt pH och minskar sedan med ytterligare ökning/minskning av pH. Aktiviteten är maximal för de flesta enzymerna vid det biologiska pH-värdet 7,4. Optimalt pH för pepsin är 1,5, surt fosfatas är 4,5 och för alkaliskt fosfatas är det 9,8.

        3. Effekt av substratkoncentration:

        När alla andra parametrar hålls konstanta inklusive enzymkoncentrationen, då, när substratkoncentrationen ökar, ökar reaktionshastigheten stadigt, tills enzymet är mättat med substratet. I detta skede ökar inte reaktionshastigheten och förblir konstant. När en graf plottas med hastighet kontra substratkoncentration ger det en hyperbolisk kurva.

        Detta beror på att när koncentrationen av substrat ökar, kombineras substratmolekylerna med alla tillgängliga enzymmolekyler på sina aktiva platser tills inga fler aktiva platser är tillgängliga. Sålunda i detta skede fyller substratet endast på ställena när produkterna frigörs och kan inte öka reaktionshastigheten.

        Km definieras som den substratkoncentration vid vilken hastigheten för den enzymkatalyserade reaktionen är hälften av den maximala hastigheten.

        i. Ett högt Km värdet indikerar svag bindning mellan enzymet och substratet.

        ii. Låg Km indikerar stark bindning.

        Begränsningar för Michaelis-Mentens ekvation:

        i. Denna ekvation möjliggör beräkning av det ungefärliga värdet av den maximala hastigheten och inte det exakta värdet.

        ii. Det håller bra för enzymer som endast har en aktiv plats och inte den allosteriska sidan.

        iii. Den beräknar Km för monosubstratreaktioner och inte för multisubstratreaktioner.

        iv. Det används för att känna till hastigheten för icke-regulatoriska enzymer men inte för regulatoriska enzymer.

        För att övervinna ovanstående begränsningar ritas en linjeväver-Burke-plot för att etablera en relation mellan de ömsesidiga substratkoncentrationerna och hastigheten.

        Line weaver-Burke plot:

        Om vi ​​inverterar Michaelis-Mentens ekvation får vi

        Med denna ekvation kan vi beräkna exakt:

        i. Hastigheten för varje enzymkatalyserad reaktion.

        ii. Reaktionshastigheten där mer än ett substrat är närvarande.

        iii. Hastigheten för alla enzymer.

        Regulatoriska enzymer ger en sigmoidkurva och icke-regulatoriska enzymer ger en hyperbolisk kurva.

        4. Effekt av enzymkoncentration:

        När enzymkoncentrationen ökar, ökar reaktionshastigheten stadigt i närvaro av en överskottsmängd av substrat, varvid de andra faktorerna hålls konstanta. En linjär kurva produceras.

        5. Effekt av produkter:

        När produkten är mer i reaktionsblandningen, minskar reaktionshastigheten på grund av återkopplingsinhibering.

        6. Effekt av ljus:

        Aktivitetshastigheten för olika enzymer ändras i ljusets olika våglängder ex. blått ljus ökar aktiviteten av salivamylas medan U.V. ljus minskar hastigheten.

        7. Effekt av joner:

        Närvaro eller frånvaro av särskilda joner förstärker eller minskar aktiviteten hos enzymer ex. Pepsinogen omvandlas till pepsin i närvaro av H+-joner. Kinaser verkar i närvaro av Mg+2-joner.

        Enzymspecificitet:

        Enzymer är mycket specifika i sin reaktion. De verkar antingen på ett visst substrat eller katalyserar en viss reaktion.

        Följaktligen är enzymspecificiteten av två typer:

        1. Reaktionsspecificitet:

        Dessa enzymer är specifika för vilken typ av reaktion de katalyserar, oavsett vilket substrat de verkar på. Sålunda åstadkommer olika enzymer olika reaktioner på samma substrat, dvs enzymer är specifika för en viss reaktion oavsett vilket substrat det kan vara ex. aminosyror påverkas både av aminosyraoxidas som oxiderar aminosyrorna till ketosyror och dekarboxylas som tar bort koldioxid från dem.

        2. Substratspecificitet:

        Dessa enzymer är specifika för substratet på vilket de verkar. Detta klassificeras vidare enligt följande.

        (a) Absolut specificitet:

        Dessa enzymer är mycket specifika och verkar endast på ett särskilt substrat och inget annat substrat. Ex. Ureas, katalas, aspartas.

        (b) Relativ specificitet:

        Dessa enzymer verkar på en viss bindning. Ex. D-aminosyraoxidas.

        (c) Gruppspecificitet:

        Dessa enzymer verkar endast på en viss grupp.

        Är ett proteolytiskt enzym som verkar på peptidbindningar från aromatiska aminosyror som tyrosin, tryptofan och fenylalanin.

        Är specifik för basiska aminosyror. Därför spjälkar den peptidbindningar från lysin och arginin.

        Verkar på peptidbindning nära den fria aminoänden.

        Specifik för fri karboxylgrupp.

        Specifik för a-1 → 4 glykosidbindningar.

        (d) Stereospecificitet:

        Dessa enzymer verkar på en speciell stereoisomer.

        i. Succinatdehydrogenas:

        Är specifik för stereoisomeren fumarat, dvs cis-formen av dubbelbindning.

        Är specifik för β-glykosidbindning.

        iii. L-aminosyraoxidaser:

        Verkar endast på L-aminosyror och inte på D-aminosyror.

        De är icke-protein, värmestabila, lågmolekylära dialyserbara organiska föreningar som krävs för verkan av enzymer. Generellt fungerar vitaminer som koenzymer ex. biotin, pyridoxin etc. Enzym tillsammans med ett koenzym är känt som ‘holoenzym’ och det utan ett koenzym är ett ‘apoenzym’. Apoenzym (protein) + Co-enzym (icke-protein) → Holoenzym (aktivt enzymprotein).

        Holoenzym kan innehålla en organisk eller oorganisk förening (metalljoner) eller båda. Om organiska ämnen är närvarande med enzymer är de kända som ‘ko-enzymer’ och om oorganiska ämnen verkar med enzymerna kallas de som ‘kofaktorer’ (Mg, Mn, Zn, Co, Se , etc.).

        Rollen för co-enzymer är:

        (i) De fungerar som samsubstrat eller andra substrat ex. Pyruvat + NADH → Laktat + NAD+. NADH fungerar som ett koenzym eller andra substrat,

        (ii) De hjälper till att överföra grupper antingen väte eller andra grupper än väte, och

        (iii) Specifik aktivitet hos ett koenzym är antalet enheter av koenzym som finns i ett milligram enzymprotein.

        Enzymenhet eller aktivitet:

        En enhet för enzymaktivitet är mängden enzym som omvandlar 1,0 (J.M av substratet per minut till produkterna vid 25°C.

        Specifik aktivitet hos ett enzym:

        Det definieras som antalet enzymenheter per milligram av proteinet.

        Enzymomsättningsnummer:

        Antalet substratmolekyler som transformeras per minut (tidsenhet) av ett enda enzym är känt som enzymomsättningstal. Kolsyraanhydras har det högsta omsättningstalet på 36 000 000.

        Första och andra ordningens reaktion:

        En reaktion där det bara finns ett substrat kallas för 1:a ordningens reaktion. En reaktion där två substrat är inblandade för att bilda en produkt kallas 2:a ordningens reaktion, även känd som bisubstratreaktion. Detta involverar antingen enkel förskjutning (dvs båda substraten binder till två aktiva ställen i enzymet samtidigt) eller dubbel förskjutning (pingis-förskjutning, där endast ett substrat binder till enzymets aktiva ställe vid en given tidpunkt, när detta väl har frigjorts det andra substratet binder).

        Den inaktiva formen av ett enzym är känd som zymogen eller pro-enzym. Pepsinogen och trypsinogen är zymogener av pepsin respektive trypsin.

        Ribonukleinsyror som katalyserar en reaktion som liknar enzymer kallas ribozymer. Dessa ribozymer hjälper till vid bearbetningen av det nyligen transkriberade RNA ex. litet nukleärt RNA (SnRNA) och hetero-nukleärt RNA (hnRNA).

        Enzyminhibering:

        Förändring i enzymaktiviteten av andra specifika ämnen än ospecifika ämnen som pH, temperatur etc. kallas enzymhämning.

        Det finns två typer av enzymhämningar:

        1. Irreversibel enzymhämning:

        Enzymets aktivitet hämmas av kovalent bindning av inhibitorn vid det aktiva stället. Enzyminhibitorbindningen kan inte dissocieras, så den är permanent och irreversibel, dvs den kan inte vändas.

        i. Aldolas hämmas permanent av jodacetat.

        ii. Di-isopropylfluorfosfat (DFP), en komponent av nervgas, hämmar de flesta matsmältningsenzymer permanent hos människor. Därför är den väldigt giftig.

        iii. Paraklorkvicksilverbensoat (PCMB) hämmar enzymerna hexokinas och ureas irreversibelt.

        iv. Organiska reagenser som alkaloidreagens hämmar enzymer irreversibelt.

        2. Reversibel enzymhämning:

        Hämmarna binder reversibelt till enzymet och är därför inte permanent. Hämningen kan vändas genom olika mekanismer.

        (a) Konkurrerande enzymhämning:

        Det är en typ av reversibel hämning där det finns konkurrens mellan substrat och inhibitor om det aktiva stället för ett enzym på grund av den strukturella likheten. Alla icke-regulatoriska enzymer visar kompetitiv hämning. Clinically competitive enzyme inhibition is of great importance since most of the drugs act by competitive inhibition.

        (i) The enzyme succinate dehydrogenase’s (SDH) substrate is succinic acid and the competitive inhibitors are oxalic acid, mallonic acid and glutaric acid. Among these, mallonic acid is the most potent competitive inhibitor of SDH.

        (ii) Folic acid, a vitamin for human beings has para-amino benzoic acid (PABA) as one of its components. Whereas it is not a vitamin for microorganisms i.e., they cannot utilize preformed folic acid from external source, instead they synthesize their own folic acid from aba. Sulpha drugs contain para-amino sulphonate which is structurally similar to PABA and hence competes for the enzyme active site of folic acid synthesis in microorganisms. If excess dose of sulpha drug is given, it results in inhibition of folic acid synthesis thus acting as an antibiotic. Human beings are not affected, because they do not synthesize folic acid.

        (iii) Methanol is acted upon by the enzyme alcohol dehydrogenase forming formaldehyde which is highly poisonous. If ethanol if given to methanol intoxicated patients then ethanol competitively binds to alcohol dehydrogenase thereby preventing formation of formaldehyde.

        (iv) Allopurinol is the competitive inhibitor of the enzyme xanthine oxidase whose substrate is hypoxanthine. Allopurinol prevents the formation of uric acid by competitive inhibition because it has structural similarity to hypoxanthine. This principle is used in the treatment of gout i.e. abnormal accumulation of uric acid crystals in the joint causing inflammation.

        (v) Glaucoma is a condition in which there is accumulation of fluid in the lens resulting in enlargement of eye. This can be treated with ‘acetazolamide’ which inhibits the enzyme carbonic anhydrase competitively. This prevents water formation and subsequent release of more water through the urine.

        (b) Non-competitive enzyme inhibition:

        It is shown by regulatory enzymes, also called allosteric enzymes.

        These are the enzymes that contain a site other than the active site which is called ‘allosteric site’. The action of some enzymes is regulated by ‘effectors’ which can bind reversibly to the enzyme molecule at specific sites other than the substrate binding site called the modulator site or the allosteric site.

        There is no competition between substrate and inhibitor for the active site since the inhibitor or modulator binds at the modulator site or allosteric site. If the binding of the effector causes inhibition of the enzyme action then it is called a negative effector and the process is called ‘allosteric inhibition’.

        If the enzyme reaction is activated by a modulator then it is called a positive modulator or effector and the process is called ‘allosteric activation’.

        Ex. Phosphofructo kinase (PFK) is an allosteric enzyme of the glycolytic pathway.

        The positive modulators of this enzyme are AMP and ADP.

        The negative modulators of PFK are ATP and citrate.

        These are substances (generally proteinacious in nature) that inhibit most of the digestive enzymes, ex. certain roundworms and hookworms survive in the intestine by secreting anti enzymes. Uncooked rice contains certain proteins that act as anti enzymes.

        Reversible covalent modification:

        Enzyme activity can be regulated by reversible covalent modification.

        It is regulated by cyclic inter-conversion of enzyme into two forms:

        The inter-conversion is brought about by a ‘converting enzyme’. The process of activation and inactivation of the enzyme is generally brought about by covalent phosphorylation or de-phosphorylation of the target enzyme. For example hormones like epinephrine, glucagon etc. bind to the hormone receptor site on the cell membrane and activate the enzyme adenyl cyclase, which in turn converts ATP to cyclic AMP (cAMP). This cAMP converts inactive protein kinase to active protein kinase (‘a’ form). This protein kinase phosphorylates many enzymes in the cell, some of which become active and yet some others become inactive.

        The inactive phosphorylase (‘b’ form) gets converted to active phosphorylase (‘a’ form) upon phosphorylation and affects the breakdown of glycogen to glucose. On the other hand glycogen synthase becomes inactive upon phosphorylation thereby inhibiting the formation of glycogen.

        Diagnostic Importance of Enzymes:

        Enzymes were classified into two groups based upon their clinical importance as ‘functional plasma enzymes’ i.e., those enzymes present in the plasma in considerably high amounts and are functional in the plasma due to the presence of their substrate in it.

        Ex. serum lipase, blood clotting enzymes, and ‘non-­functional plasma enzymes’ i.e., those enzymes that are present in the plasma in negligible amounts and have no function in the plasma due to the absence of their substrate in it. Non-functional plasma enzymes are of diagnostic importance.

        The non-functional plasma enzymes are present in higher concentration in tissues and very low concentration in the plasma i.e. in trace amounts, but their concentration in plasma increases immediately following tissue injury or destruction.

        If there is tissue damage leading to cell rupture then the enzymes present in that tissue leaks into the blood leading to the increase in the concentration of these enzymes in the plasma. Increase in the level of non-functional plasma enzymes in the blood, indicates the disorder to the tissue where they exist. Different enzymes exist in different tissues in varying levels. Damage to a specific tissue releases a particular enzyme. Therefore estimation of enzymes in the plasma has a diagnostic importance.

        The non-functional plasma enzymes include lactate dehydrogenase (LDH), creatine phosphokinase (CPK), alanine amino transferase (ALT) or serum glutamate pyruvate transaminase (SGPT), aspartate transaminase (AST) or serum glutamate oxaloacetate transaminase (SGOT), sorbitol dehydrogenase, alkaline phosphatase, acid phosphatase, amylase, pancreatic lipase etc.

        However functional plasma enzymes are already in higher concentration in the plasma, hence their decrease in the concentration in the plasma indicates malfunction of the organ where they are synthesized ex. blood clotting enzymes are synthesized in the liver hence decrease in their concentration indicates liver dysfunction.

        Anyway an immediate assessment of the liver function cannot be made by this assessment because by the time the enzyme concentration in the plasma decreases (may take 4 to 5 days), the liver must have regained its normal vitality.

        Diagnosis of Myocardial Infarction using Enzyme Assay:

        There are three main enzymes that are used in the diagnosis of myocardial infarction (1) Lactate dehydrogenase (LDH) (2) Creatine phosphokinase (CPK)—marker enzyme and (3) Transaminase (AST or SGOT).

        (1) Lactate dehydrogenase (LDH):

        LDH catalyses the inter conversion of pyruvate to lactate, a very important reaction of anaerobic glycolysis. Glycolysis occurs in each and every cell, in some cells it is always anaerobic (RBC) whereas in others it is aerobic sometimes and anaerobic at some other time (muscle tissue, liver, kidney etc.).

        In other words LDH is present in each and every cell of the body. Therefore damage to any of the tissues of the body results in release of LDH into the plasma. Hence it becomes a difficult task to trace out the organ from which it has leaked.

        However LDH exists in five isoenzyme forms i.e. multiple forms of the same enzyme (These enzymes bring about the same reaction but exhibit different physical characters like molecular weight, charge, electrophoretic mobility, Km and isoelectric pH). The polypeptides in LDH are designated as ‘H chain’ and ‘M chain’.

        All the isoenzyme forms of LDH are tetramer i.e. has four polypeptides in the following combinations:

        (e) M4 or LDH5—Liver and skeletal muscle

        All these isomers have been successfully separated on Sodium Dodecyl Sulphate Polyacryl Amide Gel Electrophoresis (SDS-PAGE) and their banding pattern from the plasma is established as under—

        LDH1 or H4 is predominantly present in the cardiac muscle, whereas the isoenzyme form LDH5 or M4 is more abundant in the skeletal muscle. These two enzymes have different Km values and Km is indirectly proportional to affinity (Km a 1/affinity).

        The skeletal muscle enzyme M4 has low Km value for pyruvate and hence greater affinity for pyruvate resulting in high rate of conversion of pyruvate to lactate. The cardiac isoenzyme LDH1 or H4 has high Km value for pyruvate hence lesser affinity for pyruvate, therefore low rate of conversion of pyruvate to lactate. Thus the concentration of H4 or LDH1 isoenzyme form of lactate dehydrogenase increases in the plasma during myocardial infarction. The peak levels of LDH are maintained in the plasma for 6 days following the attack, after which it starts receding in its concentration.

        (2) Creatine phosphokinase (CPK):

        This is known as the marker enzyme for the diagnosis of myocardial infarction or heart attack, because this is the first enzyme to increase within a short time in the blood plasma following a heart attack. CPK is an enzyme that catalyses the conversion of creatine to creatine phosphate, a high energy compound that works to supply energy during muscle contraction. Therefore this enzyme is present only in a few tissues like the cardiac muscle, skeletal muscle and the brain.

        CPK also exists in various isoenzyme forms. It has two polypeptides ‘B’ & ‘M’ that form dimers in the following combinations to give rise to three isoenzymes of CPK.

        MB — Predominant in cardiac muscle

        MM — Predominant in skeletal muscle

        Thus estimation of the isoenzyme MB is indicative of heart attack. CPK maintains a higher concentration in the plasma for 1-2 days. The concentration of CPK after the first attack is 10 times more than the normal and if another attack occurs within a day or two the concentration further increases to 100 fold and a third attack within a short span of time raises the level of CPK to 300 fold which is lethal concentration.

        Among the two transaminases, aspartyl transaminase (AST or SGOT) increases in the plasma following an attack and the higher levels are seen in 4 to 5 days following an attack.


        Z and S Mutations of the 㬑-Antitrypsin Gene and the Risk of Chronic Obstructive Pulmonary Disease

        Chronic obstructive pulmonary disease (COPD) has been associated with heterozygosity for the Z and S alleles of the α1-antitrypsin gene in some studies, but these observations have not been confirmed by others. Cigarette smoking is the major risk factor for COPD and may have been a confounding factor in many of the previous studies. We investigated whether the Z or S alleles were more prevalent in a group of heavy smokers with COPD than in a group of nonobstructed smokers. Forced expiratory volume in 1 s and forced vital capacity were derived for 266 patients undergoing lobar or lung resection. These lung-function measurements were used to divide the patients into a COPD group and a group of nonobstructed control subjects. The subjects were typed for the Z and S alleles of the α1-antitrypsin gene using a polymerase chain reaction–based technique. In the COPD patients, 12 of 193 (6%) were heterozygous for the Z allele (MZ) compared with 0 of 73 control subjects, which gave a P value of 0.04 after correction for age, gender, and smoking history. There was no association of the S allele with COPD. The results indicate that the Z, but not the S, allele is a risk factor for COPD in the heterozygous state.

        Chronic obstructive pulmonary disease (COPD) is characterized by decreased expiratory flow rates, increased pulmonary resistance, and hyperinflation. The processes that underlie these symptoms are thought to be proteolytic destruction of the lung parenchyma and inflammatory narrowing of the peripheral airways.

        The association between very low serum concentrations of α1-antitrypsin and pulmonary emphysema was originally described by Laurell and Eriksson (1). α1-Antitrypsin is a serine protease inhibitor (Pi) that primarily binds neutrophil elastase and therefore prevents the breakdown of elastic tissue, mainly in the lung. More than 70 different biochemical variants, or Pi types, have been described (2). The most common variant, M, consists of at least six subtypes, all characterized by normal serum α1-antitrypsin levels. The Z and S variants are associated with α1-antitrypsin deficiency. The population prevalences for the MM, MS, and MZ genotypes among whites are 86, 9, and 3%, respectively (3). MM individuals have normal levels of α1-antitrypsin, whereas MS and MZ individuals have mean levels of 75% and 57% of normal, respectively. Individuals with the ZZ genotype have severe α1-antitrypsin deficiency, with mean levels at ∼ 15% of normal, and are at increased risk for COPD (4). Homozygosity for the S allele results in a mean α1-antitrypsin level ∼ 52% of normal and occurs in ∼ 0.1% of whites (5, 6). Individuals with the SS genotype may have an increased risk for emphysema (7, 8). SZ compound heterozygotes are also at risk for COPD (9).

        The issue of whether the Z and S alleles are risk factors for COPD in the heterozygous state remains controversial. Several case–control studies have found a higher prevalence of MZ heterozygotes among COPD patients than in control populations (7, 8, 10-15). However, comparisons of MZ individuals with MM subjects from the general population have generally found no excess risk of COPD (or decline in respiratory function) associated with MZ heterozygosity (16-23).

        We have investigated the prevalence of α1-antitrypsin genotypes in a group of heavy cigarette smokers with and without airway obstruction. The subjects for both groups were selected on the basis of their development of bronchogenic cancer, which resulted in a study population with a high level of exposure to cigarette smoke. Therefore, the COPD patients could be compared with individuals who had maintained normal airway function despite being chronic heavy smokers. Measurements of lung elastic recoil (maximal static recoil pressure [P l max]) and emphysema were available for the majority of subjects. Therefore, we were able to investigate whether the Z allele was associated with emphysema and loss of elastic recoil, as suggested by previous studies (24). By employing a polymerase chain reaction (PCR) method to genotype the samples, we were able to include individuals in the study for whom only paraffin-embedded tissue samples were available.

        Subjects for the study were recruited from 532 patients undergoing lobar or lung resection. Before surgery, the patients completed an interviewer-administered questionnaire regarding smoking history, occupational exposure to dusts or fumes, and respiratory symptoms. Lung-function measurements made on each patient included subdivisions of lung volume measured in a pressure-compensated body plethysmograph, and maximal expiratory flow and volume. Values of forced expiratory volume in 1 s (FEV1), forced vital capacity (FVC), and the FEV1/FVC ratio were calculated. In 63% of the subjects a pressure volume curve of the lung was also obtained, from which the P l max was derived as previously described (25). In 68% of the subjects, resected lung samples were graded for emphysema as previously described (26).

        Any patients in whom the lung lesion was obstructing a segmental or larger bronchus, or in whom there was evidence of significant obstructive pneumonitis, were not included in the study because these conditions may influence lung function. There were 28 nonsmokers who were excluded from the study groups.

        On the basis of the lung function tests, the remaining 504 patients were divided into those with and without significant airway obstruction. Obstructed patients were those who had an FEV1 < 80% predicted and an FEV1/ FVC < 70%. Nonobstructed patients were those who had an FEV1 > 85% predicted and an FEV1/FVC > 75%. There were 219 patients classified as obstructed, and 73 as nonobstructed. All of the patients were of white ancestry. We were able to extract and amplify DNA successfully from 266 of these subjects, including 193 obstructed and 73 nonobstructed patients. In this population the mean age was 63 ± 10 yr, and mean cigarette smoking was 55 ± 33 pack-yr. The 212 subjects with intermediate levels of lung function were not used in the study.

        Genomic DNA was extracted from frozen lung-tissue samples, peripheral blood leukocytes (27), or paraffin-embedded tissue samples (28) by standard techniques.

        Detection of the Pi Z allele was performed by a modification of the PCR method described by Dry (29). For PCR amplification of the region of exon V containing the Z mutation, the following oligonucleotide primers were used: 5′TAAGGCTGTGCTGACCATCGTC3′ and 5′CAAAGGGTTTGTTGAACTTGACC3′.

        PCR was carried out in a 20-μl volume containing 100 ng genomic DNA 1 μM of each primer 200 μM each of dGTP, dCTP, dTTP, and dATP 1.5 mM MgCl2 and 0.5 U Taq DNA polymerase. Amplification conditions were 40 cycles of 94°C for 30 s, 59°C for 30 s, and 72°C for 10 s. Samples were then digested at 65°C with 10 U of TaqI restriction enzyme, and electrophoresed on 3% agarose gels stained with ethidium bromide. The amplification produced a 110-base pair (bp) product and introduced a TaqI restriction site into the wild-type M allele but not into the Z allele. Therefore, after TaqI digestion, the M allele was cut into 89- and 21-bp bands, whereas the Z allele remained as a 110-bp band (Figure 1 ).

        Fig. 1. Analysis of the α1-antitrypsin Z and S mutations using restriction endonuclease digestion. (A) TaqI digestion of PCR products amplified from exon V yields an 89-bp fragment from the M allele and a 110-bp fragment from the Z allele. (B) TaqI digestion of PCR products amplified from exon III yields a 98-bp fragment from the M allele and a 78-bp fragment from the S allele. L = 100-bp DNA ladder.

        Analysis of the S allele in exon III was performed by a similar method. Primers were designed so that the upstream primer introduced an artificial TaqI restriction site in the M allele but not in the S allele. Primers for this analysis were 5′GAGGGGAAACTACAGCACCTCG3′ and 5′ACCCTCAGGTTGGGGAATCACC3′. The PCR was carried out using the same conditions as the Z mutation. The amplification produced a 98-bp product that was subsequently digested with 10 U of TaqI. The M allele sequence contained a TaqI restriction site and therefore was cut into 78- and 20-bp bands, but the S allele remained as a 98-bp band (Figure 1 ). Samples of these restriction enzyme analyses were confirmed using sequence-specific oligonucleotide (SSO) probes as described by Bruun-Petersen and colleagues (30).

        The associations of the Z and S mutations with obstruction were tested by the score test from logistic regression. Analyses were adjusted for the effects of age, sex, and smoking. Smoking was examined by cigarette years: the number of years smoked times the number of cigarettes smoked per day.

        The mean physiologic and morphologic data for the two groups are shown in Table 1. Because the obstructed and nonobstructed groups were significantly different for age, sex, and smoking, the results were corrected for these potentially confounding factors by logistic regression.

        Table 1. Population characteristics and pulmonary function values in obstructed versus nonobstructed individuals

        The prevalence of MS heterozygosity in all of the study subjects was 23 of 266 (9%). In addition, 2 of 266 (1%) subjects were found with the SS genotype. The distribution of genotypes was consistent with previous studies of white populations (3). The results are summarized according to phenotype in Table 2. The genotypes of all the MS and SS individuals were confirmed using the SSO method.

        Table 2. Prevalence of S and Z alleles of the α1-antitrypsin gene in obstructed and nonobstructed subjects

        * Adjusted for age, sex, and smoking history.

        In the obstructed group, 16 of 193 subjects (8%) were MS, compared with 7 of 73 (10%) in the nonobstructed subjects. The two SS homozygotes were from the obstructed group. The FEV1 values for these subjects were 71% and 70% predicted, and the FEV1/FVC values were 64% and 61%. The odds ratio associated with the MS/SS genotypes was 0.80 (95% CI = 0.29, 2.18) after correction for age, sex, and smoking history, and was not significant (P = 0.65).

        Twelve of 266 (4%) of the subjects in the study were heterozygous for the Z allele, and no ZZ individuals were detected. These data were consistent with previous population studies of white individuals (3). The prevalence of the MZ genotype in the obstructed and nonobstructed groups is summarized in Table 2. All of the MZ genotypes were confirmed by SSO typing.

        The Z allele was found in 12 of 193 (6%) of the obstructed group compared with 0 of 73 subjects in the nonobstructed control group. The MZ genotype was associated with airway obstruction after correction for age, sex, and smoking history (P = 0.04). It was not possible to calculate an odds ratio for this genotype because none of the control group had the mutation. There were no significant differences in mean P l max % predicted (89% versus 80%, P = 0.62) or mean emphysema score (14 versus 16, P = 0.77) in obstructed subjects with the MZ genotype versus obstructed patients with the MM genotype.

        Previous studies of α1-antitrypsin deficiency alleles and the risk of COPD have been of two designs. First, case– control studies were used to compare the prevalence of MZ and MS heterozygotes in groups of COPD patients and in control subjects. The usual finding from these studies was that the presence of the MZ genotype was a significant risk factor for COPD (7, 8, 10-15). The major criticism of these studies has been that the cases and controls were ascertained separately with different recruitment strategies. This may lead to a systematic difference between cases and controls (e.g., in ethnic background) that may bias the results.

        The second type of study designed to detect an effect of S and Z heterozygosity involved selecting samples of individuals with MZ or MS genotypes for comparison with MM individuals. For the most part these population studies have shown no increased risk of impaired lung function with heterozygosity for either allele (16-23). The major problem with these studies is that they have insufficient power to detect a factor that produces a modest increase in risk. In addition, many of the subjects in these studies were not old enough to have developed COPD or were nonsmokers. However, in some population studies MZ individuals were found to have significantly worse lung function (14, 31-35).

        In the present study we used a novel design to improve the power of the case–control approach and decrease the chance of ascertainment bias. By selecting only those individuals who have smoked enough to develop lung cancer we attempted to ensure that both the cases and the controls had a high exposure to the most important risk factor for airway obstruction. However, the obstructed group was older, had smoked more, and had a higher percentage of males than the nonobstructed group. These differences may have accounted for the development of COPD in the obstructed group. Therefore, we adjusted the results of the analyses by logistic regression.

        The genotype frequencies in our study subjects (9% MS, 4% MZ) were similar to those found in general white populations (9% MS, 3% MZ) (3). We did not identify any ZZ homozygotes in our study groups. Previous studies have found that 1 to 3% of COPD patients have the ZZ genotype (8, 11). We may have found fewer ZZ homozygotes than expected because our subjects were recruited from lung cancer patients. It is possible that ZZ individuals would have experienced fatal loss of lung function before they could have smoked enough to develop lung cancer. Alternatively, these individuals may have had early onset COPD with lung function sufficiently impaired to preclude lung resection.

        There was no association of the MZ genotype with emphysema or loss of elastic recoil. However, we cannot rule out such associations because the number of MZ subjects for whom these data were available was small (emphysema score, n = 7 P l max, n = 5). In addition, although patients who have COPD and are homozygous ZZ often have a pure form of emphysema, they may also present with primarily airway disease (36).

        Because all subjects were ascertained in the same way, the risk for a systematic bias in the genotype distribution was minimized. However, we recognize the possibility that an association observed in patients with lung cancer may not be applicable to the general population.

        We devised genotyping protocols that allowed detection of the Z and S alleles by PCR. The products of the amplification were designed to be short DNA fragments of approximately 100 bp. This enabled us to analyze DNA extracted from archival material in the form of blocks of paraffin-embedded tissue. DNA from such a source is frequently degraded, and it is often only possible to amplify small molecules. This approach permitted us to use the considerable patient resources available as pathologic specimens. By using a mismatched primer in the PCR reaction we were able to genotype the samples using TaqI restriction enzyme. This is a rapid, reliable, and inexpensive procedure that allowed efficient study of a large number of samples.

        The results demonstrated no difference in the prevalence of MS heterozygotes in the obstructed group compared with the nonobstructed. This result may reflect the fact that the S allele is a mild deficiency variant and if an increased risk of COPD is associated with the allele, it would be expected to be small. In some case–control studies an increased prevalence of MS genotypes in COPD patients has been reported (7, 8), whereas in others no association was found (12, 13, 15). Population studies have failed to detect increased risk of impaired lung function associated with the MS genotype (16, 18, 20-23). However, it is possible that the S allele may contribute to the susceptibility to COPD in conjunction with other factors (either genetic or environmental). The two individuals with the SS genotype had COPD, consistent with previous observations that this genotype is more prevalent in subjects with airway obstruction (7, 8).

        The Z allele causes a more severe deficiency of α1-antitrypsin, and the results of this study show that all of the MZ individuals in our population had COPD. This association was significant even after correction for potentially confounding factors such as age and smoking history. These results support previous studies that have suggested that the Z allele is a risk factor for COPD in the heterozygous state (7, 8, 10-15). The data indicate that intermediate deficiency of α1-antitrypsin enhances the decline in lung function that accompanies chronic exposure to cigarette smoke.

        In summary, we have used a novel study design to examine further the risk for COPD associated with S and Z heterozygosity. Although there was no increased risk for COPD associated with the presence of the S allele, we found that the prevalence of MZ individuals was increased in the COPD group compared with control subjects.


        Titta på videon: alpha 1 antitrypsin deficiency (Augusti 2022).