Information

5.12: Biosyntes - Biologi

5.12: Biosyntes - Biologi



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

5.12: Biosyntes

Beräkningsbiolog @ NSW

Kort positionsbeskrivning: Garvan Institute of Medical Research samlar världsledande läkare och grundläggande och translationella forskare för att bryta ner barriärer mellan traditionella vetenskapliga discipliner och hitta lösningar på sjukdomar. Grundades 1963, Garvans uppdrag är att utnyttja all information som är kodad i vårt genom för att bättre diagnostisera, behandla, förutsäga och förebygga sjukdomar.

Våra forskare arbetar över fyra korsande forskningsteman: medicinsk genomik, epigenetik och cellulär genomik sjukdomar av immunitet och inflammation cancer och åldrande sjukdomar som påverkar skelett, hjärna och metabolism. Dessutom har Garvan tre stora centra: Kinghorn Center for Clinical Genomics, Garvan-Weizmann Center for Cellular Genomics och Center for Population Genomics.

Denna position är baserad på Center for Population Genomics (CPG), ett gemensamt initiativ från Garvan Institute of Medical Research (Garvan) i Sydney och Murdoch Children's Research Institute (MCRI) i Melbourne.

CPG:s vision är en värld där genomisk information möjliggör omfattande sjukdomsförutsägelse, korrekt diagnos och effektiv behandling för alla människor. CPG:s syfte är: Att etablera respektfulla partnerskap med olika samhällen, samla in och analysera genomisk data i transformativ skala och driva genomisk upptäckt och rättvis genomisk medicin i Australien.

CPG leds av experter inom samhällsengagemang, mjukvaruutveckling, genomisk analys och projektledning. Direktör Daniel MacArthur har tidigare varit meddirektör för medicinsk och befolkningsgenetik vid Broad Institute of MIT och Harvard, där han ledde utvecklingen av Genome Aggregation Database (gnomAD), den största och mest använda samlingen av mänskliga DNA-sekvenseringsdata i världen.

Vi söker en beräkningsbiolog för att bidra till utvecklingen av nya analyspipelines för storskaliga genomiska datauppsättningar, för att tillämpa dessa pipelines på allt större mänskliga genomiska datauppsättningar och för att arbeta nära med annan centerpersonal och externa forskare för att genomföra och publicera nya analyser av data. Beräkningsbiologen kommer att ansluta sig till ett mycket samarbetande team inklusive annan analys- och metodutvecklingspersonal, mjukvaruingenjörer, projektledare, community-specialister och praktikanter.

Som en del av uppdraget för Center for Population Genomics kommer detta team att ansvara för att hantera data som genereras genom nya sekvenseringsprojekt samt aggregering av offentliga resurser för att skapa en ny resurs för mänsklig genetik som speglar Australiens anmärkningsvärda befolkningsmångfald. Teamet kommer också att hantera genom, exome, RNA-seq och andra genomiska datauppsättningar från patienter med sällsynta sjukdomar och deras familjemedlemmar, med målet att förbättra diagnosen av allvarliga genetiska sjukdomar. Dessa analyser kommer att utföras inom en skalbar molnbaserad beräkningsplattform. De resulterande datamängderna och programvaran kommer att delas brett med det bredare forskarsamhället, vilket maximerar deras inverkan på vetenskap och hälsoresultat.

Även om denna position kommer att involvera direkt exponering för banbrytande genomisk vetenskap, kommer mått på framgång och marknadsföring att vara på att utveckla och distribuera komplexa analysmetoder i stor skala, och inte på traditionella akademiska mätvärden som ledande publikationer. Dessa tjänster är centralt finansierade och är inte beroende av stipendier eller annan insamling. Dessa roller kommer att vara bäst lämpade för personer med en stark meritlista av vetenskaplig produktion som är intresserade av att fortsätta bidra till effektfull vetenskap men inte i det traditionella akademiska karriärspåret.

För att anpassa oss till effekterna av covid-19 har vi lanserat centret under en helt avlägsen modell och är öppna för avlägsna positioner på längre sikt.

Detta är en 3-årig heltidstjänst med en årslöneintervall mellan $92,000 - $120,000k med hänsyn till kompetens och erfarenhet, plus pensions- och lönepaketeringsförmåner och möjligheten att förlänga.

Beräkningsbiologen kommer att ingå i centrets analysteam, som kommer att ansvara för att utveckla skalbara pipelines för komplexa genomiska analyser, för att arbeta nära centrets mjukvaruutvecklingsteam för att implementera dessa i produktionsskala över data från tiotusentals individer, och för att utföra kvalitetskontroll och analys över de resulterande datamängderna. Det här teamet kommer att bestå av medlemmar med olika kompetenser inom beräkningsbiologi, statistisk genetik och populationsgenetik, som arbetar tillsammans för att skapa dessa pipelines, utföra analyser och i stor utsträckning bidra till publiceringen av högeffektiv vetenskap.

Nyckelansvaret inkluderar:

Utveckling av nya tillvägagångssätt och rigorös benchmarking av befintliga metoder för analys av storskalig genomsekvensering, RNA-seq, encellig RNA-seq och andra genomiska datatyper över tiotusentals mänskliga prover

Utveckla prototypkod för analysmetoder och arbeta nära ett mjukvaruteknikteam för att säkerställa att denna kod kan distribueras i stor skala och delas som programvara med öppen källkod

Utför rigorös kvalitetskontroll och analys av massiva genomiska datamängder

Träffa regelbundet centerpraktikanter och annan vetenskaplig personal för att identifiera stora utmaningar inom datahantering och analys, och arbeta proaktivt med andra teammedlemmar för att definiera lösningar

Bidra aktivt till vetenskapliga diskussioner kring de bästa metoderna för att förstå de stora datamängder som genereras och hanteras av centret

Bidra aktivt till utvecklingen av bästa praxis för programmering och analys genom regelbundna kodgranskningsmöten och andra aktiviteter som parprogrammering

De viktigaste färdigheterna och erfarenheterna inkluderar:

Antingen en magister eller doktorsexamen i beräkningsbiologi, funktionell genomik, maskininlärning, statistik eller ett relaterat område, eller en motsvarande total mängd direkt arbetslivserfarenhet inom dessa områden

Betydlig erfarenhet av Python och R, eller liknande

Visad erfarenhet av att arbeta i högpresterande eller molnbaserade miljöer

Demonstrerad erfarenhet av versionskontroll och programvarulager

Direkt erfarenhet av att utföra kvalitetskontroll och analys av genomiska datauppsättningar eller andra komplexa datatyper

Mycket autonom och självmotiverad: kan definiera och hantera genomförandet av nya strategier för analys över deras expertområde

God skriftlig kommunikationsförmåga: kan bidra effektivt till papper och tekniska rapporter

En genuin passion för mjukvaruutveckling med öppen källkod och att bidra med kod till det bredare beräkningsbiologiska ekosystemet

Mycket samarbetsvillig: mer fokuserad på att lösa viktiga biologiska och medicinska problem genom att arbeta med andra än att säkra individuell kredit och villiga att engagera sig med andra teammedlemmar från olika bakgrunder för att utföra komplexa vetenskapliga uppgifter

En problemlösningsmentalitet: kunna navigera i en komplex och dynamisk serie av tekniska hinder, och att svänga snabbt när det behövs, att bygga ett första i sitt slag forskningsprojekt någon som identifierar problem även om de faller utanför sitt omedelbara uppdrag, och arbetar med andra teammedlemmar för att lösa dem

Direkt erfarenhet av cloud computing och analys av mycket stora genomiska datauppsättningar skulle vara fördelaktigt

Direkt erfarenhet av komplex datavisualisering eller maskininlärning skulle också vara ett plus

För att söka denna tjänst, skicka in din ansökan med CV och personligt brev som ett dokument där du anger varför du är intresserad av denna roll. Vi granskar ansökningar allt eftersom de kommer in. Om du tror att du är rätt person för denna roll vill vi gärna höra hur dina förmågor, prestationer och erfarenhet skiljer dig åt. Endast sökande med fulla arbetsrättigheter i Australien är berättigade att ansöka om denna roll.


Bakgrund

Extrema miljöer, i allmänhet kännetecknade av onormal temperatur, pH, tryck, salthalt, toxicitet och strålningsnivåer, är bebodda av olika organismer - extremofiler - som är specifikt anpassade till dessa speciella förhållanden. Studier av dessa mikroorganismer har lett till utvecklingen av viktiga molekylärbiologiska tekniker såsom polymeraskedjereaktion (PCR) [1, 2] och därför har ytterligare forskning till stor del stimulerats av industrins intresse för det faktum att överlevnadsmekanismerna för dessa mikroorganismer skulle kunna omvandlas till värdefulla tillämpningar, allt från rening av avloppsvatten till diagnos av infektionssjukdomar och genetiska sjukdomar [3].

Halofila mikroorganismer är extremofiler som kan överleva hög osmolaritet under hypersalina tillstånd antingen genom att bibehålla hög salthalt i deras cytoplasma eller genom intracellulär ackumulering av osmoprotektanter som ektoin och betain [4]. C. salexigens är en halofil Gammaproteobacterium av familjen Halomonadaceae med en mångsidig metabolism som tillåter inte bara snabb tillväxt på en stor mängd enkla kolföreningar som sin enda kol- och energikälla utan också motståndskraft mot mättade och aromatiska kolväten och tungmetaller [5, 6]. C. salexigens med förmågan att växa över ett brett spektrum av salthalter [0,5-4 M NaCl] har varit den mest euryhalin av bakterierna [7] och för att förstå de osmoregulatoriska mekanismerna i halofila bakterier har den använts som en modellorganism [5, 7–9]. Dessutom, C. salexigens har också många lovande biotekniska tillämpningar som en källa till kompatibla lösta ämnen, salttoleranta och rekombinanta enzymer, biosurfaktanter och exopolysackarider [10].

Genomsekvens av extremofiler, såsom sulfatreducerande arkeon Archaeaglobus fulgidus[11], halofil arkeon Halobacterium arter NRC-1 [12] och acidofil bakterie Acidithiobacillus ferrooxidans[13] har rapporterats tidigare. Sedan publiceringen av genomet av C. salexigens DSM 3043 [14] den biologiska kunskapen om denna stam har ökat avsevärt och olika metoder som möjliggör genomisk analys och genetisk manipulation har utvecklats [15, 16]. Å andra sidan har systematisk analys av dess metaboliska och biotekniska kapacitet ännu inte utförts. Detta beror på någon nivå på bristen på en in silico omfattande metabolisk modell som möjliggör integrering av kanoniska experimentella data på ett sammanhängande sätt.

Metabolisk rekonstruktion är en icke-automatiserad och iterativ beslutsprocess genom vilken gener, enzymer, reaktioner och metaboliter som deltar i den metaboliska aktiviteten i ett biologiskt system identifieras, kategoriseras och sammankopplas för att bilda ett nätverk [17]. Rekonstruktionsprocessen har granskats konceptuellt i litteraturen [17–22] och nyligen har ett standardoperativt protokoll som ger en detaljerad översikt över nödvändiga data och steg publicerats [23]. Hittills har metaboliska rekonstruktioner i genomskala för mer än 50 organismer publicerats och detta antal förväntas öka snabbt. Därför växer behovet av att utveckla automatiserade, eller åtminstone halvautomatiska, sätt att rekonstruera metaboliska nätverk. Ett begränsat antal mjukvaruverktyg, såsom Pathway-verktyg [24], metaSHARK [25], Simpheny (Genomatica), som syftar till att hjälpa och underlätta återuppbyggnadsprocessen är tillgängliga. De senaste recensionerna [18, 26] belyser dock aktuella problem med genomkommentarer och databaser, vilket gör automatiserade rekonstruktioner utmanande och därför kräver manuell utvärdering. Genom-skala metaboliska rekonstruktioner har framgångsrikt tillämpats på flera organismer över eukaryota (t.ex. Saccharomyces cerevisiae[21, 27–29], människa [30], Arabidopsis thaliana[31]), prokaryotisk (t.ex. Escherichia coli[32–34], Bacillus subtilis[35], Helicobacter pylori[36, 37], Lactococcus lactis[38], Staphylococcus aureus[39, 40], Clostridium acetobutylicum[41], Pseudomonas putida[42], Pseudomonas aeruginosa[43], Geobacter metallireducens[44], Corynebacterium glutamicum[45]), och arkeala (t.ex. Methansoarcina barkeri[46], Halobacterium salinarum[47] arter). Eftersom de är en användbar guide för identifiering och fyllning av kunskapsluckor, har dessa metaboliska nätverk använts för simulering av det cellulära beteendet under olika genetiska och fysiologiska förhållanden, kontextualisering av data med hög genomströmning, styr hypotesdriven upptäckt, förhör av relationer mellan olika arter och topologisk analys (Se [17] för en omfattande översikt).

Här, en genom-skala rekonstruktion av C. salexigens DSM 3043:s metabolism fastställdes baserat på genomisk, biokemisk och fysiologisk information. Eftersom den var den första heltäckande metaboliska modellen av en halofil bakterie, märktes den som i OA584 enligt namnkonventionen som föreslagits av [33]. Modellens prediktiva potential validerades inte bara mot litteraturdata om in vivo C. salexigens fenotypiska egenskaper, transport och användning av olika substrat men också mot experimentella observationer på kolin-betain- och ektoinsyntesvägarna som är viktiga delar av osmoadaptationsmekanismen.


Resultat

Vi använde FOCI-nätverksmodellen för att uppskatta ett samuttrycksnätverk för 5 007 öppna läsramar för jäst (ORF). Data för denna analys är hämtade från allmänt tillgängliga mikroarraymätningar av genuttryck under en mängd olika fysiologiska förhållanden. FOCI-metoden antar en linjär modell för association mellan variabler och beräknar beroende- och oberoenderelationer för par av variabler upp till en första ordningens (det vill säga en enda) konditioneringsvariabel. Mer detaljerade beskrivningar av data och nätverksuppskattningsalgoritmen finns i avsnittet Material och metoder.

På basis av en kantmässigt falsk-positiv frekvens på 0,001 (se Material och metoder) har det uppskattade nätverket för jästuttrycksdata 11 450 kanter. Det är möjligt för FOCI-nätverksuppskattningsproceduren att ge bortkopplade subgrafer - det vill säga grupper av gener som är relaterade till varandra men inte kopplade till några andra gener. Men jästsamuttrycksnätverket som vi uppskattade inkluderar en enda jätteansluten komponent (GCC, den största subgrafen så att det finns en väg mellan varje par av hörn) med 4 686 hörn och 11 416 kanter. Den näst största anslutna komponenten inkluderar endast fyra hörn, så GCC representerar relationerna mellan majoriteten av generna i genomet. I figur 1 visar vi en förenkling av FOCI-nätverket konstruerat genom att behålla de 4 000 starkaste kanterna. Vi använde denna kanttröskelprocedur för att ge en begriplig tvådimensionell visualisering av grafen, alla resultat som diskuteras nedan härleddes från analyser av hela GCC i FOCI-nätverket.

Förenkling av jäst-FOCI-samuttrycksnätverket konstruerat genom att behålla de 4 000 starkaste kanterna (= 1 729 hörn). De färgade hörnen representerar en delmängd av de lokalt distinkta subgraferna i FOCI-nätverksbokstäverna är som i tabell 2, och ytterligare detaljer kan hittas där. Några av de lokalt distinkta subgraferna i Tabell 2 är inte representerade i denna figur eftersom de involverar subgrafer vars kantvikter inte är i de översta 4 000 kanterna.

Medel-, median- och modala värden för vertexgrad i GCC är 4,87, 4 respektive 2. Det vill säga att varje gen visar signifikanta uttrycksrelationer till ungefär fem andra gener i genomsnitt, och den vanligaste formen av relation är till två andra gener. De flesta gener har fem eller färre grannar, men det finns ett litet antal gener (349) med fler än 10 grannar i FOCI-nätverket, den maximala graden i grafen är 28 (Figur 2a). Således visar ungefär 7% av generna signifikanta uttrycksförhållanden till ett ganska stort antal andra gener. Anslutningen för FOCI-nätverket är inte förenlig med en kraftlagsfördelning (se Ytterligare datafil 1 för en log-logg-plot för denna distribution). Vi uppskattade fördelningen av vägavstånd mellan par av gener (definierat som det minsta antalet grafkanter som skiljer paret åt) genom att slumpmässigt välja 1 000 källpunkt i GCC och beräkna vägavståndet från varje källpunkt till varannan gen i nätverket (Figur 2b). Det genomsnittliga vägavståndet är 6,46 steg, och medianen är 6,0 (mod = 7). Det maximala vägavståndet är 16 steg. Därför, i GCC av FOCI-nätverket, är slumpmässiga par av gener vanligtvis separerade av sex eller sju kanter.

Topologiska egenskaper hos jäst-FOCI-samuttrycksnätverket. Distribution av (a) vertex grader och (b) väglängder för nätverket.

Koherens av FOCI-nätverket med kända metabola vägar

För att bedöma den biologiska relevansen av vårt beräknade samuttrycksnätverk jämförde vi sammansättningen av 38 kända metaboliska vägar (tabell 1) med vårt jästsamuttryck FOCI-nätverk. I ett biologiskt informativt nätverk bör gener som är involverade i samma väg(er) representeras som sammanhängande delar av den större grafen. Det vill säga, under antagandet att väginteraktioner kräver samreglering och samuttryck, bör generna i en given väg vara relativt nära varandra i det uppskattade globala nätverket.

Vi använde en sökvägsfråga för att undersöka 38 metaboliska vägar i förhållande till vårt FOCI-nätverk. För varje väg beräknade vi en kvantitet som kallas "koherensvärdet" som mäter hur väl vägen återvinns i en given nätverksmodell (se Material och metoder). Av de 38 testade vägarna har 19 koherensvärden som är signifikanta jämfört med fördelningen av slumpmässiga vägar av samma storlek (sid < 0,05 se Material och metoder). De flesta av vägarna för kolhydrat- och aminosyrametabolism som vi undersökte är konsekvent representerade i FOCI-nätverket. Av var och en av huvudkategorierna av metaboliska vägar listade i Tabell 1 är endast lipidmetabolism och metabolism av kofaktorer och vitaminer inte väl representerade i FOCI-nätverket.

De fem största koherenta vägarna är glykolys/glukoneogenes, TCA-cykeln, oxidativ fosforylering, purinmetabolism och syntes av N-glykaner. Andra vägar som är utmärkande i vår analys inkluderar glyoxylatcykeln (6 av 12 gener i största sammanhängande undernätverket), valin-, leucin- och isoleucinbiosyntes (10 av 15 gener), metioninmetabolism (6 av 13 gener), fenylalanin, tyrosin, och tryptofanmetabolism (två subnätverk vardera med 6 gener).Flera sammanhängande delmängder av FOCI-nätverket som genereras av dessa sökvägsfrågor illustreras i filen Ytterligare data 1.

Kombinerad analys av kärnkolhydratmetabolism

Förutom att vara förenlig med individuella vägar, bör en användbar nätverksmodell fånga interaktioner mellan vägar. För att utforska denna fråga frågade vi FOCI-nätverket om kombinerade vägar och mätte återigen dess koherens. Vi illustrerar en sådan kombinerad fråga baserad på fyra relaterade vägar involverade i kolhydratmetabolism: glykolys/glukoneogenes, pyruvatmetabolism, TCA-cykeln och glyoxylatcykeln.

Figur 3 illustrerar den största subgrafen som extraherats i denna kombinerade analys. Den kombinerade frågan resulterar i en delmängd av FOCI-nätverket som är större än summan av subgraferna som uppskattas separat från individuella vägar eftersom den också tillåter icke-fråga gener som är kopplade till flera vägar. Grafens noder är färgade enligt deras medlemskap i var och en av de fyra vägarna som definieras av Kyoto Encyclopedia of Genes and Genomes (KEGG). Många genprodukter tilldelas flera vägar. Detta är särskilt uppenbart med avseende på glyoxylatcykeln, de enda gener som unikt tilldelas denna väg är ICL1 (kodar ett isocitrat-lyas) och ICL2 (ett 2-metylisocitratlyas).

Största anslutna subgraf som härrör från kombinerad fråga om fyra vägar involverade i kolhydratmetabolism: glykolys/glukoneogenes (röd) pyruvatmetabolism (gul) TCA-cykel (grön) och glyoxylatcykeln (rosa). Gener som kodar för proteiner involverade i mer än en väg markeras med flera färger. Ofärgade hörn representerar icke-pathway-gener som återfanns i den kombinerade pathway-frågan. Se text för mer information.

I denna kombinerade sökvägsfråga representeras TCA-cykeln, glykolys/glukoneogenes och glyxoylatcykel var och en primärt av en enda tvåstegs ansluten subgraf (se Material och metoder). Pyruvatmetabolism å andra sidan representeras av minst två distinkta subgrafer, en inklusive <PCK1, DAL7, MDH2, MLS1, ACS1, ACH1, LPD1, MDH1> och den andra inklusive <GLO1, GLO2, DLD1, CYB2>. Denna andra uppsättning gener kodar för enzymer som deltar i en gren av pyruvatmetabolismvägen som leder till nedbrytning av metylglyoxal (metylglyoxal → L-laktaldehyd → L-laktat → pyruvat och metylglyoxal → (R)-S-laktoyl-glutation → D-laktaldehyd → D-laktat → pyruvat) [12, 13]. I grenen av metylglyoxal metabolism som involverar S-laktoyl-glutation, metylglyoxal kondenseras med glutation [12]. Intressant nog är två närliggande gener som inte är frågade, GRX1 (en granne till GLO2) och TTR1 (granne till CYB2), kodar för proteiner med glutationtransferasaktivitet.

Positionen för FBP1 i den kombinerade frågan är också intressant. Produkten av FBP1 är fruktos-1,6-bisfosfatas, ett enzym som katalyserar omvandlingen av beta-d-fruktos 1,6-bisfosfat till beta-D-fruktos 6-fosfat, en reaktion associerad med glykolys. Men i vårt nätverk är det närmast förknippat med gener som tilldelats pyruvatmetabolism och glyoxylatcykeln. Grannarna till FBP1 i denna fråga inkludera ICL1, MLS1, SFC1, PCK1 och IDP3. Med undantag för IDP3, promotorerna för alla dessa gener (inklusive FBP1) har minst en uppströms aktiveringssekvens som kan klassificeras som ett kolkälla-responselement (CSRE), och som svarar på transkriptionsaktivatorn Cat8p [14]. Denna uppsättning gener uttrycks under icke-fermentativa tillväxtförhållanden i frånvaro av glukos, förhållanden som är karakteristiska för det diauxiska skiftet [15]. Med tanke på andra gener i närheten av FBP1 i den kombinerade sökvägsfrågan finner vi det ACS1, IDP2, SIP4, MDH2, ACH1 och YJL045w har alla visat sig ha antingen CSRE-liknande aktiveringssekvenser och/eller vara åtminstone delvis Cat8p-beroende [14]. Sambandet mellan dessa Cat8p-aktiverade gener kvarstår när vi uppskattar FOCI-nätverket utan att inkludera data från DeRisi et al. [15], vilket tyder på att denna uppsättning interaktioner inte bara är en konsekvens av inkluderingen av data som samlats in från kulturer som genomgår diauxisk förändring.

Införandet av ett antal andra gener i undernätverket för kolhydratmetabolism överensstämmer med oberoende bevis från litteraturen. Till exempel McCammon et al. [16] identifierade YER053c som bland uppsättningen gener vars uttrycksnivåer förändrades i TCA-cykelmutanter.

Även om många av associationerna mellan grupper av gener som avslöjas i dessa subgrafer kan tolkas antingen i termer av frågevägarna som används för att konstruera dem eller med avseende på relaterade vägar, har ett antal associationer ingen uppenbar biologisk tolkning. Till exempel, svansen till vänster om grafen i figur 3, som består av LSC1, PTR2, PAD1, OPT2, ARO10 och PSP1 har inget klart känt samband.

Lokalt distinkta subgrafer

Analysen av metabola vägar som beskrivs ovan ger ett test av i vilken utsträckning kända vägar är representerade i FOCI-grafen. Det vill säga, vi antog viss förkunskap om nätverksstrukturen för undergrupper av gener och frågade om vårt uppskattade nätverk är koherent gentemot denna förkunskap. Omvänt kanske man vill hitta intressanta och distinkta subgrafer inom FOCI-nätverket utan att tillföra några förkunskaper och fråga om sådana subgrafer motsvarar särskilda biologiska processer eller funktioner. För att lösa detta andra problem utvecklade vi en algoritm för att beräkna "lokalt distinkta subgrafer" av jäst-FOCI-samuttrycksnätverket som beskrivs i avsnittet Material och metoder. Kortfattat är detta en oövervakad grafsökningsalgoritm som definierar "intressant" i termer av lokal kanttopologi och fördelningen av lokala kantvikter på grafen. Målet med denna algoritm är att hitta anslutna subgrafer vars kantviktsfördelning skiljer sig från kanterna som omger subgrafen, så dessa lokalt distinkta subgrafer kan ses som de hörn och tillhörande kanter som "sticker ut" från bakgrunden av den större grafen som helhet.

Vi begränsade storleken på subgraferna till att vara mellan sju och 150 gener och använde kvadratiska marginalkorrelationskoefficienter som viktningsfunktionen på kanterna av FOCI-grafen. Vi hittade 32 lokalt distinkta subgrafer, innehållande totalt 830 gener (tabell 2). Tjugofyra av de 32 subgraferna har konsekventa annoteringstermer för Gene Ontology (GO) [17] med sid-värden mindre än 10 -5 (se Material och metoder). Detta indikerar att de flesta lokalt distinkta subgrafer är mycket berikade med avseende på gener involverade i särskilda biologiska processer eller funktioner. Medlemmar av de 21 största lokalt distinkta subgraferna är markerade i figur 1. Den fullständiga listan över subgrafer och generna som tilldelats dem finns i fil med ytterligare data 2.

De fem största lokalt distinkta subgraferna har följande primära GO-annoteringar: proteinbiosyntes (subgraf A och B) ribosombiogenes och montering (subgraf C) svar på stress och kolhydratmetabolism (subgraf K) och sporulering (subgraf N). Flera av dessa subgrafer visar mycket hög specificitet för gener med speciella GO-annoteringar. Till exempel, i subgraferna A och B tilldelas cirka 97 % (32 av 33) och 95,5 % (64 av 67) av generna GO-termen "proteinbiosyntes".

Subgraf P är också relativt stor och innehåller många gener med roller i DNA-replikation och reparation. På liknande sätt har 21 av de 34 kommenterade generna i subgraf F en roll i proteinkatabolism. Tre medelstora subgrafer (S, T, U) är starkt associerade med den mitotiska cellcykeln och cytokinesen. Andra exempel på subgrafer med mycket tydliga biologiska roller är subgraf R (histoner) och subgraf Z (gener involverade i konjugering och sexuell reproduktion). Subgraf X innehåller gener med roller i metioninmetabolism eller transport.

Vissa lokalt distinkta subgrafer kan dekomponeras ytterligare. Till exempel innehåller subgraf K minst två undergrupper. En av dessa består huvudsakligen av gener som kodar för chaperoneproteiner: STI1, SIS1, HSC82, HSP82, AHA1, SSA1, SSA2, SSA4, KAR2, YPR158w, YLR247c. Den andra gruppen innehåller gener som främst är involverade i kolhydratmetabolism. Dessa två undergrupper är kopplade till varandra uteslutande genom HSP42 och HSP104.

Tre av de lokalt distinkta subgraferna - Q, W och CC - består huvudsakligen av gener för vilka det inte finns några GO biologiska processanteckningar. Intressant nog finns majoriteten av generna som tilldelats dessa tre grupper i subtelomera regioner. Dessa tre subgrafer är inte själva direkt kopplade i FOCI-grafen, så deras reglering är sannolikt inte bara ett exempel på en reglering av subtelomer tystnad [18]. Subgraf Q innehåller 26 gener, varav fem (YRF1-2, YRF1-3, YRF1-4, YRF1-5, YRF1-6) motsvarar ORF som kodar för kopior av Y'-helikasprotein 1 [19]. Åtta ytterligare gener (YBL113c, YEL077c, YHL050c, YIL177c, YJL225c, YLL066c, YLL067c, YPR204w) som tilldelas denna subgraf kodar också för helikaser. Denna helikassubgraf är nära associerad med subgraf P, som innehåller många gener involverade i DNA-replikation och reparation (se figur 1). Subgraf W innehåller 10 gener, varav endast en tilldelas en GO-process, funktion eller komponentterm. Men nio av de 10 generna i subgrafen (PAU1, PAU2, PAU4, PAU5, PAU6, YGR294w, YLR046c, YIR041w, YLL064c) är medlemmar av seripauperingenfamiljen [20], som primärt finns subtelomeriskt och som kodar för cellväggsmannoproteiner och kan spela en roll för att upprätthålla cellväggens integritet [18]. Ett annat exempel på en subgraf som motsvarar en multigenfamilj är subgraf CC, som inkluderar nio subtelomera ORF, varav sex kodar för proteiner i COS-familjen. Cos-proteiner är associerade med kärnmembranet och/eller det endoplasmatiska retikulumet och har varit inblandade i det ovikta proteinsvaret [21].

Som ett sista exempel betraktar vi subgraf FF, som består av sju ORF:er (YAR010c, YBL005w-A, YJR026w, YJR028w, YML040w, YMR046c, YMR051c) som alla är delar av Ty-element, som kodar strukturella komponenter i retrotransposonmaskineriet [22, 23]. Denna uppsättning gener illustrerar fint det faktum att avgränsning av lokalt distinkta grupper kan leda till upptäckten av många intressanta interaktioner. Det finns bara sex kanter bland dessa sju gener i den uppskattade FOCI-grafen, och de marginella korrelationerna mellan korrelationsmåtten för dessa gener är relativt svaga (medelvärde) r

0,62). Trots detta är den lokala fördelningen av kantvikter i FOCI-grafen sådan att denna grupp markeras som en subgraf av intresse. Lokalt starka subgrafer som dessa kan också användas som utgångspunkt för ytterligare grafsökningsprocedurer. Till exempel, att fråga FOCI-nätverket efter omedelbara grannar till generna i subgraf FF ger ytterligare tre ORF:er - YBL101w-A, YBR012w-B, och RAD10. Både YBL101w-A och YBR012w-B är Ty-element, medan RAD10 kodar för ett exonukleas med en roll i rekombination.


Examinerade ämnen

MIT-WHOI Joint Program in Oceanography

7.410 Tillämpad statistik

Förutsättning: Tillstånd av instruktör
G (vår)
3-0-9 enheter
Kan upprepas för kreditering.

Ger en introduktion till modern tillämpad statistik. Ämnen inkluderar sannolikhetsbaserade metoder för uppskattning, konfidensintervall och hypotestestning av bootstrapping-tidsseriemodellering av linjära modeller av icke-parametrisk regression och modellval. Organiserad kring exempel hämtade från den senaste litteraturen.

7.411 Seminarier i biologisk oceanografi

Förutsättning: Tillstånd av instruktör
G (Höst, Vår)
Enheter ordnade [P/D/F]
Kan upprepas för kreditering.

Utvalda ämnen inom biologisk oceanografi.

7.421 Problem i biologisk oceanografi

Förutsättning: Tillstånd av instruktör
G (Höst, Vår)
Enheter ordnade [P/D/F]
Kan upprepas för kreditering.

Avancerade problem inom biologisk oceanografi med tilldelad läsning och konsultation.

Information: M. Neubert (WHOI)

7.430 Ämnen i kvantitativ marin vetenskap

Förutsättning: Tillstånd av instruktör
G (Höst, Vår)
2-0-4 enheter
Kan upprepas för kreditering.

Föreläsningar och diskussioner om kvantitativ marin ekologi. Ämnen varierar från år till år.

7.431 Ämnen i marin ekologi

Förutsättning: Tillstånd av instruktör
G (höst)
2-0-4 enheter
Kan upprepas för kreditering.

Föreläsningar och diskussioner om ekologiska principer och processer i marina populationer, samhällen och ekosystem. Ämnen varierar från år till år.

7.432 Ämnen i marin fysiologi och biokemi

Förutsättning: Tillstånd av instruktör
G (vår)
2-0-4 enheter
Kan upprepas för kreditering.

Föreläsningar och diskussioner om fysiologiska och biokemiska processer i marina organismer. Ämnen varierar från år till år.

7.433 Ämnen i biologisk oceanografi

Förutsättning: Tillstånd av instruktör
G (Höst, Vår)
2-0-4 enheter
Kan upprepas för kreditering.

Föreläsningar och diskussioner om biologisk oceanografi. Ämnen varierar från år till år.

7.434 Ämnen i djurplanktonbiologi

Förutsättning: Tillstånd av instruktör
G (Höst, Vår)
2-0-4 enheter
Kan upprepas för kreditering.

Föreläsningar och diskussioner om det marina zooplanktonets biologi. Ämnen varierar från år till år.

7.435 Ämnen i bentisk biologi

Förutsättning: Tillstånd av instruktör
G (Höst, Vår)
2-0-4 enheter
Kan upprepas för kreditering.

Föreläsningar och diskussioner om den marina bentosens biologi. Ämnen varierar från år till år.

7.436 Ämnen i växtplanktonbiologi

Förutsättning: Tillstånd av instruktör
G (Höst, Vår)
2-0-4 enheter
Kan upprepas för kreditering.

Föreläsningar och diskussion om marint växtplanktons biologi. Ämnen varierar från år till år.

7.437 Ämnen i molekylärbiologisk oceanografi

Förutsättning: Tillstånd av instruktör
G (Höst, Vår)
2-0-4 enheter
Kan upprepas för kreditering.

Föreläsningar och diskussion om molekylärbiologisk oceanografi. Ämnen varierar från år till år.

7.438 Ämnen i marina djurs beteende

Förutsättning: Tillstånd av instruktör
G (Höst, Vår)
2-0-4 enheter
Kan upprepas för kreditering.

Föreläsningar och diskussion om marina djurs beteendebiologi. Ämnen varierar från år till år.

7.439 Ämnen i marin mikrobiologi

Förutsättning: Tillstånd av instruktör
G (höst)
2-0-4 enheter
Kan upprepas för kreditering.

Föreläsningar och diskussion om marina prokaryoters biologi. Ämnen varierar från år till år.

7.440 En introduktion till matematisk ekologi

Förutsättning: Calculus I (GIR), 1.018[J], eller tillstånd av instruktör
Läsår 2020-2021: Erbjuds inte
Läsår 2021–2022: G (vår)
3-0-9 enheter

Täcker de grundläggande modellerna för befolkningstillväxt, demografi, befolkningsinteraktion (konkurrens, predation, mutualism), näringsnät, skörd och infektionssjukdomar, och de matematiska verktyg som krävs för deras analys. Eftersom dessa verktyg också är grundläggande för analys av modeller inom biokemi, fysiologi och beteende, är ämnet också allmänt relevant för studenter vars intressen inte är begränsade till ekologiska problem.

7.470 Biologisk oceanografi

Förutsättning: Tillstånd av instruktör
G (vår)
3-0-9 enheter

Avsedd för studenter med avancerad utbildning i biologi. Intensiv översikt av biologisk oceanografi. Stora paradigm diskuterades och biologiska processers beroende av fysiska och kemiska aspekter av miljön undersöktes. Undersöker mångfalden av marina livsmiljöer, större grupper av taxa som bor i dessa livsmiljöer och den allmänna biologin för de olika taxa: produktion och konsumtion av organiskt material i havet, såväl som faktorer som styr dessa processer. Arternas mångfald, strukturen hos marina näringsnät och energiflödet inom olika marina livsmiljöer är detaljerade och kontrasterade.

7.491 Forskning i biologisk oceanografi

Förutsättning: Tillstånd av instruktör
G (Höst, Vår, Sommar)
Enheter ordnade [P/D/F]
Kan upprepas för kreditering.

Riktad forskning i biologisk oceanografi som inte leder till examensarbete och inleds före behörighetsprovet.

Mikrobiologi (MICRO)

7.492[J] Metoder och problem inom mikrobiologi

Samma ämne som 1.86[J], 20.445[J]
Förutsättning: Inga
G (höst)
3-0-9 enheter

Studenterna kommer att läsa och diskutera primärlitteratur som täcker nyckelområden inom mikrobiell forskning med tonvikt på metoder och tillvägagångssätt som används för att förstå och manipulera mikrober. Företräde till förstaårsstudenter i mikrobiologi och biologi.

7.493[J] Mikrobiell genetik och evolution

Samma ämne som 1.87[J], 12.493[J], 20.446[J]
Förutsättning: 7.03, 7.05 eller tillstånd av instruktör
G (höst)
4-0-8 enheter

Täcker aspekter av mikrobiella genetiska och genomiska analyser, centrala dogmer, horisontell genöverföring och evolution.

A. D. Grossman, O. Cordero

7.494 Forskningsproblem i mikrobiologi

Förutsättning: Tillstånd av instruktör
G (Höst, Vår, Sommar)
Enheter ordnade [P/D/F]
Kan upprepas för kreditering.

Riktad forskning inom områdena mikrobiell vetenskap och teknik.

7.498 Undervisningserfarenhet i mikrobiologi

Förutsättning: Tillstånd av instruktör
G (Höst, Vår)
Enheter ordnade [P/D/F]
Kan upprepas för kreditering.

För kvalificerade doktorander på forskarutbildningen Mikrobiologi som är intresserade av undervisning. Klassrums- eller laboratorieundervisning under ledning av en lärare.

7.499 Forskningsrotationer i mikrobiologi

Förutsättning: Inga. Coreq: 7,492[J] eller 7,493[J] tillstånd av instruktör
G (Höst, Vår)
Enheter ordnade [P/D/F]
Kan upprepas för kreditering.

Introducerar studenter till fakulteten som deltar i det interdepartmentala forskarutbildningen i mikrobiologi genom en serie av tre labbrotationer, som ger bred exponering för mikrobiologiforskning vid MIT. Studenter väljer ett labb för avhandlingsforskning i slutet av sitt första år. Med tanke på programmets tvärvetenskapliga karaktär och de många forskningsprogram som finns, kan studenterna kunna arbeta tillsammans med mer än en forskningshandledare. Begränsat till studenter i mikrobiologiprogrammet.

7.MTHG Mikrobiologi Examensarbete

Förutsättning: Tillstånd av instruktör
G (Höst, IAP, Vår, Sommar)
Enheter ordnade
Kan upprepas för kreditering.

Forskningsprogram som leder till skrivandet av en doktorsavhandling. Ordnas av studenten och lämplig MIT-fakultetsmedlem.

Biologi

7.50 Metod och logik i molekylärbiologi

Förutsättning: Inga. Coreq: 7,51 och 7,52 eller tillstånd av instruktör
G (höst)
4-0-8 enheter

Logik, experimentell design och metoder inom biologi, med användning av diskussioner av den primära litteraturen för att urskilja principerna för biologisk undersökning i att göra upptäckter och testa hypoteser. I samarbete med fakulteten tillämpar studenterna också dessa principer för att generera ett potentiellt forskningsprojekt, presenterat i både skriftlig och muntlig form. Begränsat till kurs 7 doktorander.

I. Cheeseman, M. Hemann, J. Lees, D. Sabatini, F. Solomon, S. Vos

7.51 Principer för biokemisk analys

Förutsättning: Tillstånd av instruktör
G (höst)
6-0-6 enheter

Principer för biokemi, betoning på struktur, jämviktsstudier, kinetik, informatik, enkelmolekylstudier och experimentell design. Ämnen inkluderar makromolekylär bindning och specificitet, proteinveckning och -veckning, allosteriska system, transkriptionsfaktorer, kinaser, membrankanaler och transportörer och molekylära maskiner.

7.52 Genetik för doktorander

Förutsättning: Tillstånd av instruktör
G (höst)
4-0-8 enheter

Principer och tillvägagångssätt för genetisk analys, inklusive Mendelsk arv och prokaryotisk genetik, jästgenetik, utvecklingsgenetik, neurogenetik och humangenetik.

H. R. Horvitz, C. Kaiser, E. Lander

7.540[J] Frontiers in Chemical Biology

Samma ämne som 5.54[J], 20.554[J]
Förutsättning: 5.07[J], 5.13, 7.06 och tillstånd av instruktör
G (höst)
3-0-9 enheter

Se beskrivning under ämne 5.54[J].

L. Kiessling, M. Axlar

7.546[J] Science and Business of Biotechnology

Samma ämne som 15.480[J], 20.586[J]
Förutsättning: Inga. Coreq: 15,401 tillstånd av instruktör
G (vår)
3-0-6 enheter

Se beskrivning under ämne 15.480[J].

7.548[J] Framsteg inom biotillverkning

Samma ämne som 10.53[J]
Ämnet möter 7.458[J], 10.03[J]
Förutsättning: Inga
G (Vår andra halvan av terminen)
1-0-2 enheter

Seminariet undersöker hur bioläkemedel, en allt viktigare klass av läkemedel, tillverkas. Ämnen sträcker sig från grundläggande bioprocesser till ny teknik till ekonomin för biotillverkning. Täcker även globaliseringens inverkan på reglering och kvalitetsmetoder samt integritet i försörjningskedjan. Studenter som tar examensversionen slutför ytterligare uppgifter.

J. C. Love, A. Sinskey, S. Springs

7.549[J] Fallstudier och strategier för upptäckt och utveckling av droger

Samma ämne som 15.137[J], 20.486[J], HST.916[J]
Förutsättning: Inga
Läsår 2020-2021: Erbjuds inte
Läsår 2021–2022: G (vår)
2-0-4 enheter

Se beskrivning under ämne 20.486[J].

7.55 Fallstudier i modern experimentell design

Förutsättning: Tillstånd av instruktör
G (vår)
2-0-7 enheter

Fokuserar på att förbättra elevernas förmåga att analysera, designa och presentera experiment, med betoning på modern teknik. Klassdiskussioner börjar med artiklar som utvecklade eller använde samtida tillvägagångssätt (t.ex. kvantitativ mikroskopi, biofysiska och molekylärgenetiska metoder) för att ta itu med viktiga problem inom biologi. Varje student förbereder ett specifikt mål för ett standardforskningsförslag för ett projekt som betonar forskningsstrategi, experimentell design och skrivande.

L. Guarente, S. Spranger

7.571 Kvantitativ analys av biologiska data (ny)

Förutsättning: Inga
G (Vår första halvan av terminen)
2-0-4 enheter

Tillämpning av sannolikhetsteori och statistiska metoder för att analysera biologiska data. Ämnen inkluderar: beskrivande och inferentiell statistik, en introduktion till Bayesiansk statistik, design av kvantitativa experiment och metoder för att analysera högdimensionella datamängder. En <em>konceptuell</em> förståelse av ämnen betonas, och metoder illustreras med hjälp av programmeringsspråket Python. Även om en grundläggande förståelse för Python uppmuntras, krävs ingen erfarenhet av programmering. Studenter som tar forskarversionen förväntas utforska ämnet mer på djupet.

7.572 Kvantitativa mätningar och modellering av biologiska system (ny)

Förutsättning: Inga
G (Vår andra halvan av terminen)
2-0-4 enheter

Kvantitativ experimentell design, dataanalys och modellering för biologiska system. Ämnen inkluderar absolut/relativ kvantifiering, brus och reproducerbarhet, regression och korrelation, och modellering av populationstillväxt, genuttryck, celldynamik, återkopplingsreglering, oscillation. Studenter som tar forskarversionen förväntas utforska ämnet mer på djupet.

7.573 Modern Biostatistics (Ny)

Ämnet möter 7.093
Förutsättning: 7.03 och 7.05
G (Vår första halvan av terminen)
2-0-4 enheter

Ger en introduktion till sannolikhet och statistik som används inom modern biologi. Diskreta och kontinuerliga sannolikhetsfördelningar, statistisk modellering, hypotestestning, Bayesiansk statistik, oberoende, betingad sannolikhet, Markov-kedjor, metoder för datavisualisering, klustring, huvudkomponentanalys, icke-parametriska metoder, Monte Carlo-simuleringar, falsk upptäcktsfrekvens. Tillämpningar på DNA, RNA och proteinsekvensanalys genetik genomik. Läxor involverar programmeringsspråket R, men tidigare erfarenhet av programmering krävs inte. Studenter som är registrerade för examensversionen slutför ett ytterligare projekt och tillämpar biostatistiska metoder på data från sin forskning.

7.574 Modern Computational Biology (Ny)

Ämnet möter 7.094
Förutsättning: 7.03 och 7.05
G (Vår andra halvan av terminen)
2-0-4 enheter

Introducerar moderna metoder inom beräkningsbiologi, med fokus på DNA/RNA/proteinsekvensanalys. Ämnen inkluderar nästa generations DNA-sekvensering och sekvenseringsdataanalys, RNA-seq (bulk och enkelcell), ribosomprofilering och proteomik. Studenter som registrerats för forskarversionen genomför ett ytterligare projekt, och tillämpar bioinformatiska metoder på data från sin forskning.

7.58 Molekylärbiologi

Ämnet möter 7.28
Förutsättning: 7.03, 7.05 och tillstånd av instruktör
G (vår)
5-0-7 enheter

Detaljerad analys av de biokemiska mekanismerna som styr underhållet, uttrycket och utvecklingen av prokaryota och eukaryota genom. Ämnen som behandlas i föreläsningar och läsningar av relevant litteratur inkluderar: genreglering, DNA-replikation, genetisk rekombination och mRNA-translation. Logik i experimentell design och dataanalys betonas. Presentationerna innehåller både föreläsningar och gruppdiskussioner av representativa artiklar från litteraturen. Studenter som tar forskarversionen förväntas utforska ämnet mer på djupet.

7.59[J] Undervisning i naturvetenskap och teknik på högskolenivå

Samma ämne som 1.95[J], 5.95[J], 8.395[J], 18.094[J]
Ämnet möter 2.978
Förutsättning: Inga
Läsår 2020-2021: Erbjuds inte
Läsår 2021–2022: G (höst)
2-0-2 enheter

Se beskrivning under ämne 5.95[J].

7.60 Cellbiologi: kärnans struktur och funktioner

Förutsättning: 7.06 eller tillstånd av instruktör
G (vår)
3-0-9 enheter

Eukaryot genomstruktur, funktion och uttryck, bearbetning av RNA och reglering av cellcykeln. Betoning på de tekniker och logik som används för att ta itu med viktiga problem inom kärncellsbiologi. Föreläsningar om breda ämnesområden inom kärncellsbiologi och diskussioner om representativa aktuella uppsatser.

7.61[J] Eukaryot cellbiologi: principer och praxis

Samma ämne som 20.561[J]
Förutsättning: Tillstånd av instruktör
G (höst)
4-0-8 enheter

Betona metoder och logik som används för att analysera struktur och funktion hos eukaryota celler i olika system (t.ex. jäst, fluga, mask, mus, mänsklig utveckling, stamceller, neuroner). Kombinerar föreläsningar och fördjupade rundabordssamtal om litteraturläsningar med aktivt deltagande av fakultetsexperter. Fokuserar på membran (struktur, funktion, trafik), organeller, cellytan, signaltransduktion, cytoskelett, cellmotilitet och extracellulär matris. Spänner från grundläggande studier till tillämpningar på mänskliga sjukdomar, samtidigt som man betonar kritisk analys av experimentella tillvägagångssätt. Begränsad registrering.

7.62 Mikrobiell fysiologi

Ämnet möter 7.21
Förutsättning: 7.03, 7.05 och tillstånd av instruktör
G (höst)
4-0-8 enheter

Biokemiska egenskaper hos bakterier och andra mikroorganismer som gör att de kan växa under en mängd olika förhållanden. Interaktion mellan bakterier och bakteriofager. Genetisk och metabolisk reglering av enzymverkan och enzymbildning. Struktur och funktion av komponenter i bakteriecellhöljet. Proteinsekretion med särskild tonvikt på dess olika roller i patogenesen. Ytterligare ämnen inkluderar bioenergetik, symbios, kvorumavkänning, globala svar på DNA-skador och biofilmer. Studenter som tar forskarversionen förväntas utforska ämnet mer på djupet.

G.C. Walker, A.J. Sinskey

7,63[J] Immunologi

Samma ämne som 20.630[J]
Ämnet möter 7.23[J], 20.230[J]
Förutsättning: 7.06 och tillstånd av instruktör
G (vår)
5-0-7 enheter

Omfattande undersökning av molekylära, genetiska och cellulära aspekter av immunsystemet. Ämnen inkluderar medfödda och adaptiva immunitetsceller och organ i immunsystemet hematopoies immunoglobulin, T-cellsreceptor och major histocompatibility complex (MHC) proteiner och gener utveckling och funktioner hos B- och T-lymfocyter immunsvar mot infektioner och tumörer överkänslighet, autoimmunitet och immunbrister . Särskild uppmärksamhet på utvecklingen och funktionen av immunsystemet som helhet, som studerats av moderna metoder och tekniker. Studenter som tar forskarversionen utforskar ämnet mer på djupet, inklusive studier av nyare primärlitteratur.

S. Spranger, M. Birnbaum

7.64 Molekylära mekanismer, patologi och terapi av mänskliga neuromuskulära sjukdomar

Förutsättning: Tillstånd av instruktör
Läsår 2020-2021: Erbjuds inte
Läsår 2021–2022: G (vår)
3-0-9 enheter

Undersöker den molekylära och kliniska grunden för centrala nervsystem och neuromuskulära störningar med särskild tonvikt på strategier för terapeutisk intervention. Överväger den djupgående analysen av kliniska egenskaper, patologiska mekanismer och svar på aktuella terapeutiska interventioner. Täcker neurodegenerativa sjukdomar, såsom Huntingtons sjukdom, Parkinsons sjukdom, Alzheimers sjukdom, Amyotrop lateral Schlerosis, Frontal Temporal Demens och neuromuskulära störningar, såsom Myotonisk Dystrofi, Facio Scapular Humoral Dystrophy och Duchenne Muskeldystrofi.

7.65[J] Molecular and Cellular Neuroscience Core I

Samma ämne som 9.015[J]
Förutsättning: Inga
G (höst)
3-0-9 enheter

Se beskrivning under ämne 9.015[J].

7.66 Molekylär grund för infektionssjukdomar

Ämnet möter 7.26
Förutsättning: 7.06 och tillstånd av instruktör
Läsår 2020-2021: Erbjuds inte
Läsår 2021–2022: G (vår)
4-0-8 enheter

Fokuserar på principerna för värd-patogen-interaktioner med tonvikt på infektionssjukdomar hos människor. Presenterar nyckelbegrepp för patogenes genom studiet av olika mänskliga patogener. Innehåller kritisk analys och diskussion av tilldelade läsningar. Studenter som tar forskarversionen förväntas utforska ämnet mer på djupet.

7.68[J] Molecular and Cellular Neuroscience Core II

Samma ämne som 9.013[J]
Förutsättning: Tillstånd av instruktör
G (vår)
3-0-9 enheter

Se beskrivning under ämne 9.013[J].

7.69[J] Utvecklingsneurobiologi

Samma ämne som 9.181[J]
Ämnet möter 7.49[J], 9.18[J]
Förutsättning: 9.011 eller tillstånd av instruktör
G (vår)
3-0-9 enheter

Se beskrivning under ämne 9.181[J].

7.70 Reglering av genuttryck

Förutsättning: Tillstånd av instruktör
Läsår 2020-2021: Erbjuds inte
Läsår 2021–2022: G (vår)
4-0-8 enheter

Seminariet undersöker grundläggande principer för biologisk reglering av genuttryck. Fokuserar på exempel som underbygger dessa principer, såväl som de som utmanar vissa långvariga åsikter. Ämnen som behandlas kan inkludera rollen av transkriptionsfaktorer, förstärkare, DNA-modifieringar, icke-kodande RNA och kromatinstruktur i regleringen av genuttryck och mekanismer för epigenetisk nedärvning av transkriptionella tillstånd. Begränsat till 40.

7.71 Biofysisk teknik

Ämnet möter 5,78
Förutsättning: 5.13, 5.60, (5.07[J] eller 7.05), och tillstånd från instruktör
G (vår)
5-0-7 enheter

Introducerar studenterna till moderna biofysiska metoder för att studera biologiska system från atomära, till molekylära och cellulära skalor. Innehåller en djupgående diskussion om teknikerna som täcker hela upplösningsområdet, inklusive röntgenkristallografi, elektron- och ljusmikroskopi. Diskuterar andra vanliga biofysiska tekniker för makromolekylära karakteriseringar. Föreläsningar täcker teoretiska principer bakom teknikerna, och studenterna får praktiska laborationer med hjälp av instrumentering som finns tillgänglig vid MIT. Möter med 5,78 när det erbjuds samtidigt.

7.72 Stamceller, regenerering och utveckling

Förutsättning: Tillstånd av instruktör
G (vår)
4-0-8 enheter

Ämnen inkluderar olika stamceller, såsom muskel-, tarm-, hud-, hår- och hematopoetiska stamceller, samt pluripotenta stamceller. Ämnen behandlar cellpolaritet och cellöde positionsinformation och mönster för utveckling och regenerering av lem, hjärta och helkroppsregenerering stamcellsförnyande stamceller i utvecklingssvar på sår och tillämpningar av stamceller vid utveckling av terapier. Diskussioner om uppsatser kompletterar föreläsningar.

7.73 Principer för kemisk biologi

Förutsättning: 7.05 och tillstånd av instruktör
G (vår)
Erbjuds inte regelbundet konsultera avdelning
3-0-9 enheter

Spänner över områdena biologi, kemi och ingenjörskonst, behandlar klassen principerna för kemisk biologi och dess tillämpning av kemiska och fysikaliska metoder och reagenser för att studera och manipulera biologiska system. Ämnen inkluderar bioortogonala reaktioner och aktivitetsbaserad proteinprofilering, hämmare av små molekyler och kemisk genetik, fluorescerande prober för biologiska studier och onaturlig aminosyramutagenes. Täcker även kemisk biologi tillvägagångssätt för att studera dynamiska post-translationella modifieringsreaktioner, biosyntes och mutasyntes av naturliga produkter och screening av läkemedel med hög genomströmning. Studenter som tar forskarversionen förväntas utforska ämnet mer på djupet.

7.74[J] ​​Ämnen i biofysik och fysikalisk biologi

Samma ämne som 8.590[J], 20.416[J]
Förutsättning: Inga
G (höst)
Erbjuds inte regelbundet konsultera avdelning
2-0-4 enheter

Se beskrivning under ämne 20.416[J].

I. Cisse, N. Fakhri, M. Guo

7.76 Ämnen i makromolekylär struktur och funktion

Förutsättning: Tillstånd av instruktör
Läsår 2020-2021: Erbjuds inte
Läsår 2021–2022: G (vår)
3-0-6 enheter

Fördjupad analys och diskussion av klassisk och aktuell litteratur, med tonvikt på struktur, funktion och mekanismer hos proteiner och andra biologiska makromolekyler.

7.77 Nukleinsyror, struktur, funktion, evolution och deras interaktioner med proteiner

Förutsättning: 7.05, 7.51 eller tillstånd av instruktör
G (vår)
3-0-9 enheter

Undersöker primärlitteratur, med fokus på biokemiska, biofysiska, genetiska och kombinatoriska metoder för att förstå nukleinsyror. Ämnen inkluderar de allmänna egenskaperna, funktionerna och strukturella motiven för DNA och RNA RNA som katalysatorer och som regulatorer av genuttryck RNA redigering och övervakning, och interaktionen av nukleinsyror med proteiner, såsom zink-fingerproteiner, modifieringsenzymer, aminoacyl- tRNA-syntetaser och andra proteiner i translationsmaskineriet. Innehåller några föreläsningar men är mest analys och diskussion av aktuell litteratur i samband med studentpresentationer.

D. Bartel, U. RajBhandary

7.80 Grunderna i kemisk biologi

Ämnet möter 5.08[J], 7.08[J]
Förutsättning: 5,13 och (5,07[J] eller 7,05)
G (vår)
4-0-8 enheter

Spänner över områdena biologi, kemi och teknik, introducerar denna klass eleverna till principerna för kemisk biologi och tillämpningen av kemiska och fysikaliska metoder och reagenser för att studera och manipulera biologiska system. Ämnen inkluderar nukleinsyrastruktur, igenkänning och manipulation av proteinveckning och stabilitet, och proteostas bioortogonala reaktioner och aktivitetsbaserad proteinprofilering kemisk genetik och småmolekylära hämmare screening fluorescerande prober för biologisk analys och avbildning och onaturlig aminosyramutagenes. Klassen kommer också att diskutera logiken i dynamiska post-translationella modifieringsreaktioner med tonvikt på kemiska biologiska tillvägagångssätt för att studera komplexa processer inklusive glykosylering, fosforylering och lipidering. Studenter som tar forskarversionen förväntas utforska ämnet mer på djupet.

B. Imperiali, L. Kiessling, R. Raines

7.81[J] Systembiologi

Samma ämne som 8.591[J]
Ämnet möter 7.32
Förutsättning: (18.03 och 18.05) eller tillstånd av instruktör
G (höst)
3-0-9 enheter

Se beskrivning under ämne 8.591[J].

7.82 Ämnen om utveckling av däggdjur och genetik

Förutsättning: Tillstånd av instruktör
Läsår 2020-2021: Erbjuds inte
Läsår 2021–2022: G (vår)
3-0-9 enheter

Seminarium som täcker embryologiska, molekylära och genetiska metoder för utveckling hos möss och människor. Ämnen inkluderar preimplantationsutveckling gastrulation embryonala stamceller, geninriktning och nukleär omprogrammering av somatiska celler genomisk prägling X-inaktivering könsbestämning och könsceller.

7.85 Kräftans kännetecken

Ämnet möter 7.45
Förutsättning: Inga. Coreq: 7,06 tillstånd av instruktör
G (höst)
4-0-8 enheter

Ger en omfattande introduktion till grunderna för cancerbiologi och cancerbehandling. Ämnen inkluderar cancergenetik, genomik och epigenetik familjära cancersyndrom signaltransduktion, cellcykelkontroll och apoptos cancermetabolism stamceller och cancermetastas cancer immunologi och immunterapi konventionella och molekylärt riktade terapier och tidig upptäckt och förebyggande. Studenter som tar examensversionen slutför ytterligare uppgifter.

T. Jacks, M. Vander Heiden

7.86 Bygga med celler

Ämnet möter 7,46
Förutsättning: 7.03 och 7.05
G (höst)
4-0-8 enheter

Fokuserar på grundläggande principer för utvecklingsbiologi genom vilka celler bygger organ och organismer. Analyserar stamcellernas centrala roll vid underhåll eller reparation av vävnader och vid behandling av sjukdomar. Utforskar hur man integrerar denna kunskap med tekniska verktyg för att konstruera funktionella vävnadsstrukturer. Studenter som tar examensversionen slutför ytterligare uppgifter.

7.89[J] Ämnen i beräknings- och systembiologi

Samma ämne som CSB.100[J]
Förutsättning: Tillstånd av instruktör
G (höst)
2-0-10 enheter

Se beskrivning under ämne CSB.100[J]. Företräde till förstaårs CSB-doktorander.

7.930[J] Forskningserfarenhet inom Biopharma

Samma ämne som 20.930[J]
Förutsättning: Inga
G (vår)
2-10-0 enheter

Se beskrivning under ämne 20.930[J].

7.931 Oberoende studie i biologi

Förutsättning: Tillstånd av instruktör
G (Höst, Vår)
Enheter ordnade [P/D/F]
Kan upprepas för kreditering.

Studie- eller forskningsprogram arrangeras med en institutionsfakultetsmedlem.

7.932 Oberoende studie i biologi

Förutsättning: Tillstånd av instruktör
G (Höst, Vår)
Enheter ordnade
Kan upprepas för kreditering.

Studie- eller forskningsprogram arrangeras med en institutionsfakultetsmedlem.

7.933 Forskningsrotationer i biologi

Förutsättning: Tillstånd av instruktör
G (Höst, Vår)
Enheter ordnade [P/D/F]
Kan upprepas för kreditering.

Introducerar studenter till fakulteten som deltar i biologiprogrammet genom en serie labbrotationer, som ger bred exponering för biologiforskning vid MIT. Studenter väljer ett labb för avhandlingsforskning i slutet av sitt första år. Begränsat till studenter i biologiprogrammet.

7.934 Undervisningserfarenhet i biologi

Förutsättning: Tillstånd av instruktör
G (Höst, Vår)
Enheter ordnade [P/D/F]
Kan upprepas för kreditering.

För kvalificerade doktorander på biologiforskarprogrammet intresserade av undervisning. Klassrums- eller laboratorieundervisning under ledning av en lärare.

7.935 Ansvarsfullt uppförande i biologi

Förutsättning: Tillstånd av instruktör
G (höst)
Enheter ordnade [P/D/F]

Sessioner fokuserar på ett ansvarsfullt bedrivande av vetenskap. Överväger journalföring och rapporteringsroller för mentors och adeptens författarskap, granskning och sekretess för att lösa konflikter missbruk och missbrukssamarbeten, konkurrerande intressen och immateriella rättigheter och korrekt praxis vid användning av djur och mänskliga ämnen. Begränsat till andraårs doktorander i biologi.

7.936 Professionell utveckling i biologi

Förutsättning: Inga
G (Höst, Vår)
0-2-0 enheter

Krävs för kurs 7 doktorander för att få professionellt perspektiv i karriärutvecklingsaktiviteter såsom praktik, vetenskapliga möten och karriär- och nätverksevenemang. Skriftlig rapport krävs efter avslutad verksamhet.

7.941 Forskningsproblem

Förutsättning: Tillstånd av instruktör
G (Höst, Sommar)
Enheter ordnade [P/D/F]
Kan upprepas för kreditering.

Riktad forskning inom ett område av biologisk vetenskap, men inte bidragande till examensarbete.

Konsultera Biology Education Office

7.942 Forskningsproblem

Förutsättning: Tillstånd av instruktör
G (vår)
Enheter ordnade [P/D/F]
Kan upprepas för kreditering.

Riktad forskning inom ett område av biologisk vetenskap, men inte bidragande till examensarbete.

Konsultera Biology Education Office

7.95 Cancerbiologi

Förutsättning: 7,85 och tillstånd av instruktör
G (vår)
3-0-9 enheter

Avancerat seminarium med intensiv analys av historisk och aktuell utveckling inom cancerbiologi. Ämnen behandlar principer för apoptos, principer för cancerbiologi, cancergenetik, cancercellsmetabolism, tumörimmunologi och terapi. Detaljerad analys av forskningslitteratur, inklusive viktiga rapporter publicerade under senare år. Begränsad registrering.

7.98[J] Neural plasticitet i inlärning och minne

Samma ämne som 9.301[J]
Förutsättning: Tillstånd av instruktör
G (vår)
3-0-6 enheter

Se beskrivning under ämne 9.301[J]. Juniorer och seniorer kräver instruktörens tillstånd.

7.S930 Specialämne i biologi

Förutsättning: Tillstånd av instruktör
G (Höst, Vår, Sommar)
Enheter ordnade [P/D/F]
Kan upprepas för kreditering.

Täcker material inom olika biologiområden som inte erbjuds av de ordinarie undervisningsämnena.

7.S931 Specialämne i biologi

Förutsättning: Tillstånd av instruktör
G (Höst, Vår, Sommar)
Enheter ordnade [P/D/F]
Kan upprepas för kreditering.

Täcker material inom olika biologiområden som inte erbjuds av de ordinarie undervisningsämnena.

7.S932 Specialämne i biologi

Förutsättning: Tillstånd av instruktör
G (Höst, IAP, Vår)
Erbjuds inte regelbundet konsultera avdelning
Enheter ordnade [P/D/F]
Kan upprepas för kreditering.

Täcker material inom olika biologiområden som inte erbjuds av de ordinarie undervisningsämnena.

7.S939 Specialämne i biologi

Förutsättning: Tillstånd av instruktör
G (Höst, IAP, Vår)
Erbjuds inte regelbundet konsultera avdelning
Enheter ordnade
Kan upprepas för kreditering.

Täcker material inom olika biologiområden som inte erbjuds av de ordinarie undervisningsämnena.

7.THG Examensarbete i biologi

Förutsättning: Tillstånd av instruktör
G (Höst, IAP, Vår, Sommar)
Enheter ordnade
Kan upprepas för kreditering.


Material och metoder

Stammar, media och tillväxtförhållanden

S. cerevisiae stam BY4741 (MATTA a, his3Δ, leu2A0, met15A0, uraA025 användes och odlades i syntetiskt komplett medium vid 30°C. Celler odlades till en densitet av 1 x 107 celler per ml. Kulturer delades upp i två NaAsO2 (100 μM och 1 mM i två biologiska upprepningar) sattes till en kultur och båda inkuberades vid 30°C i 0,5, 2 eller 4 timmar. Celler pelleterades och tvättades i destillerat vatten före RNA-extraktion. Raderingsstammar (jap1Δ, cadlΔ, arrlΔ och rpn4Δ) med samma bakgrund erhölls från Research Genetics, bekräftades och behandlades på samma sätt, under 2 timmar och 100 μM NaAsO2.

RNA-extraktion

För cDNA-hybridiseringsexperimenten isolerades totalt RNA med användning av en syra-fenol-metod. Pellets återsuspenderades i 4 ml lysbuffert (10 mM Tris-HCL pH 7,5, 10 mM EDTA, 0,5% SDS). Fyra milliliter sur (vattenmättad, lågt pH) fenol tillsattes följt av vortexning. De lyserande celllösningarna inkuberades vid 65°C under 1 timme med enstaka kraftig vortexning och placerades sedan på is i 10 minuter innan de centrifugerades vid 4°C i 10 minuter. De vattenhaltiga skikten återextraherades med fenol (rumstemperatur, ingen inkubation) och extraherades en gång med kloroform. Natriumacetat sattes sedan till 0,3 M med 2 volymer absolut etanol, placerades vid -20°C under 30 minuter och centrifugerades sedan. Pellets tvättades två eller tre gånger med 70 % etanol följt av Qiagen Poly(A) + RNA-rening med urvalssteget Oligotex oligo (dT). Totalt RNA för de specifika knockout-stammarna och moderexperimentet isolerades genom enzymatisk reaktion, enligt RNeasy-jästprotokollet (Qiagen).

Mikroarrayhybridiseringar och analyser

Ett cDNA-jästchip, utvecklat internt vid National Institute of Environmental Health Sciences (NIEHS), användes för genuttrycksprofileringsexperiment. En fullständig lista över ORF:erna på detta chip finns på [70]. cDNA-mikroarraychips framställdes som tidigare beskrivits [71, 72]. cDNA:t sågs som beskrivits [73]. Varje poly(A) RNA-prov (2 μg) märktes med Cy3- eller Cy5-konjugerad dUTP (Amersham) genom en omvänd transkriptionsreaktion med användning av omvänt transkriptas SuperScript (Invitrogen) och primeroligo (dT) (Amersham). Hybridiseringarna och analysen utfördes såsom beskrivits Hewitt et al. [74] förutom att gener med normaliserade intensitetsvärden utanför ett 95 % konfidensintervall ansågs vara signifikant differentiellt uttryckta. Listor över differentiellt uttryckta gener deponerades i NIEHS MAPS-databasen [75]. Gener som uttrycktes differentiellt i minst tre av de fyra replikatexperimenten kompilerades och klustrades därefter med hjälp av Cluster/Treeview-mjukvaran [76]. GeneSpring (Silicon Genetics) och Cytoscape [28] användes för att ytterligare analysera och visualisera data.

Knockout-experimenten utfördes på en Agilent jäst oligo array-plattform. Prover av 10 μg totalt RNA märktes med hjälp av Agilent fluorescent direct label kit-protokollet och hybridiseringar utfördes i 16 timmar i en roterande hybridiseringsugn med hjälp av Agilent 60-mer oligo microarray-bearbetningsprotokoll. Objektglasen tvättades som indikerat och skannades med en Agilent-skanner. Data samlades in med hjälp av Agilent funktionsextraktionsprogramvara, med standardinställningar för alla parametrar, spara förhållandets termer. För att ta hänsyn till användningen av direktetikettsprotokollet ändrades feltermer till: Cy5 multiplikativt fel = 0,15 Cy3 multiplikativt fel = 0,25 Cy5 additivt fel = 20 Cy3 additivt fel = 20.

GEML-filer och bilder exporterades från Agilent-funktionsextraktionsmjukvaran och deponerades i Rosetta Resolver (version 3.2, build 3.2.2.0.33) (Rosetta Biosoftware). Två arrayer för varje provpar, inklusive en fluoromvändning, kombinerades till förhållandeexperiment i Rosetta Resolver. Intensitetsdiagram genererades för varje kvotexperiment och gener ansågs vara "signaturgener" om sid-värdet var mindre än 0,001. sid-värden beräknades med hjälp av Rosetta Resolver-felmodellen med Agilent-feltermer. Signaturgenerna analyserades med GeneSpring. Hela den interna och Agilent-baserade datamängden är tillgänglig i Ytterligare datafiler.

Ontologiberikning

Gener har tidigare kategoriserats i olika ontologier och vägar. Om en viss väg berikas för gener som uttrycks signifikant som svar på en process, drar vi slutsatsen att vägen sannolikt kommer att vara involverad i denna process. Totalt hade 829 gener av 6 240 en signifikant förändring i uttryck i minst ett experimentellt tillstånd. Tillsammans med storleken på varje funktionskategori beräknades ett statistiskt mått för anrikningens signifikans med hjälp av ett hypergeometriskt test. Signifikansnivån för detta test bestämdes med Bonferroni-korrigeringen, där α-värdet sattes till 0,05 och antalet tester som utfördes för KEGG-väg och förenklad genontologi (biologisk process) var 27 respektive 11.

Nätverkssökningar

ActiveModules-algoritmen användes för att identifiera stadsdelar i det reglerande nätverket som motsvarar signifikanta nivåer av differentiellt uttryck. I denna sökning, om ett protein har många grannar, är det troligt att ett fåtal slumpmässigt kommer att visa signifikanta förändringar i uttrycket och dessa kan väljas som ett betydande undernätverk. Grannskapspoäng är en metod vi använde för att korrigera för denna snedvridning. I detta schema måste ett betydande delnätverk innehålla antingen alla eller inga av grannarna till varje protein. Signifikansen representerar då ett aggregat över alla grannar till ett protein. Detta förhindrar det partiska urvalet av några få topprankade proteiner från ett stort område i sökandet efter betydande undernätverk. För en djupgående beskrivning av denna algoritm, se Ideker et al. [1].

Vid definitionen av nätverket som användes i den metaboliska analysen, eliminerades kanter som motsvarar metaboliter som länkar mer än 175 reaktioner. Detta utesluter metaboliska kofaktorer som ATP, NADH och H2O från sökningen. Poäng för varje ORF genererades genom att kartlägga fitnesssignifikansvärdet till ett Z-poäng. För att tilldela poäng till de individuella reaktionerna användes Försters kartläggning från ORF till reaktion för att generera en lista med ORF för varje reaktion. Z-poängen för dessa ORF aggregerades sedan till en enda poäng för den reaktionen med hjälp av följande ekvation:

Vi använde en dynamisk programmeringsalgoritm anpassad från Kelley et al. [77] för att identifiera vägar med höga poäng i detta nätverk. Kortfattat, den högst poänggivande längden (n) som slutar vid varje nod bestäms genom att kombinera poängen för den individuella noden och den högst poänggivande längdvägen (n - 1) slutar på en grannod med följande formel:

Eftersom en nod med många grannar är mer sannolikt att tillhöra en väg med höga poäng av en slump, korrigeras poängen för grannvägen mot extremvärdesstatistiken med antalet observationer lika med antalet grannar.

Betydelsen av de topprankande nätverken bestämdes genom jämförelse med en fördelning av de topprankande nätverken från slumpmässiga data (reaktionspoäng randomiserade med avseende på nätverkets noder). Efter att ha kört sökvägssöknings-/poängalgoritmen lades poängen för den enskilt högst poänggivande vägen till nollfördelningen. Denna process upprepades under 10 000 interaktioner. Denna nollfördelning användes sedan för att bestämma en empiri sid-värde, som representerar nollhypotesen att det inte finns någon signifikant korrelation mellan topologin för det metabola nätverket och tilldelningen av signifikansvärden till noder i det nätverket.

Specifikt raderingsexperimentfilter på jämförelser med veckändringar

Intensitetsdiagrammen genererades från varje experiment i Rosetta Resolver. En gen ansågs vara en signaturgen om sid-värdet var mindre än 0,001 och om veckändringsvärdet var större än eller lika med dubbelt. Signaturgener sändes sedan på intensitetsdiagrammet och exporterades som textfiler. Listor importerades till GeneSpring. Funktionen "Filter vid veckändring" användes för att jämföra föräldrakontrollen kontra förälder-AsIII-experimentet med varje raderingsexperiment (AsIII). Genlistan som valdes för varje filter vid analys av veckförändringar var en kombination av föräldersignaturgenlistan och signaturgenlistan för den AsIII-behandlade deletionen som analyserades vid den tidpunkten. Till exempel, om jämförelsen gjordes mellan förälder (AsIII-behandlad) och Yap1 (AsIII-behandlad), var listan som användes i analysen kombinationen av modersignaturgenerna och Yap1-signaturgenerna. Filtret på veckändringsfunktion rapporterar gener som valdes från det ena tillståndet (föräldern) som hade normaliserade datavärden som var större eller mindre än de i det andra tillståndet (radering under utredning) med en faktor på två gånger. Varje resulterande genlista sparades. Alla resulterande genlistor kombinerades och en kommenterad genlista exporterades för användning i Eisens Cluster/Treeview-paket (beskrivits tidigare). Formatet för den exporterade datan var den naturliga loggen. Genträdet som genererades för papperet genererades i GeneSpring. Varje filter vid veckändring sparades som en kommenterad genlista.

Generering av specifika "minus"-listor för borttagningsexperiment

Signaturgenlistor genererades i Rosetta Resolver från intensitetsdiagram som beskrivits ovan. Varje signaturgenlista sparades som en "Bioset" i Resolver. Moderbiosetet jämfördes med varje deletionsbioset med hjälp av "Minus"-funktionen. Denna funktion hittar de medlemmar i Bioset grupp 1 (förälder) som inte finns i Bioset grupp 2 (radering). Var och en av de resulterande listorna sparades som en ny bioset. Den nya "minus" Bioset sändes på motsvarande intensitetsdiagram och exporterades som en textfil. Detta upprepades för varje experiment med finjustering av data med hjälp av GeneSpring.

Fenotypisk profilering

Homozygota diploida deletionsstammar och sammanslagning av stammarna gjordes som beskrivits [66]. Alikvoter odlades till logaritmisk fas, späddes till OD600 0,05-0,1, delas i rör och behandlas med arsenik under 1-2 timmar vid 1 mM, 2 mM och 5 mM koncentrationer. Liknande svar observerades vid varje koncentration, så resultaten slogs samman. Dessa kulturer och ett skenbehandlat prov hölls i logaritmisk fastillväxt genom periodisk utspädning under 16-18 timmar. UPTAG- och DOWNTAG-sekvenser amplifierades separat från genomiskt DNA från läkemedlet och skenbehandlade prover med PCR med användning av biotinmärkta primrar som beskrivits tidigare [66]. Amplifieringsprodukterna kombinerades och hybridiserades till Tags3-matriser (Affymetrix). Procedurer för PCR-amplifiering, hybridisering och skanning gjordes enligt beskrivningen [66], och enligt tillverkarens rekommendation när det är tillämpligt. Bilderna kvantifierades med hjälp av programvaran Affymetrix Microarray Suite. UPTAG- och DOWNTAG-värdena normaliserades separat, proportionerades (behandlad provsignal/kontroll) och filtrerades för intensiteter över bakgrunden [78].


Storskalig upptäckt och karakterisering av proteinregulatoriska motiv i eukaryoter

Den ökande förmågan att generera storskalig, kvantitativ proteomisk data har fört med sig utmaningen att analysera sådana data för att upptäcka sekvenselementen som ligger till grund för proteinbeteende på systemnivå. Här visar vi att korta, linjära proteinmotiv effektivt kan återvinnas från datauppsättningar i proteomskala som subcellulär lokalisering, molekylär funktion, halveringstid och proteinöverflödsdata med hjälp av en informationsteoretisk metod. Med detta tillvägagångssätt har vi identifierat många kända proteinmotiv, såsom fosforyleringsställen och lokaliseringssignaler, och upptäckt ett stort antal kandidatelement. Det uppskattar vi

80% av dessa är nya förutsägelser genom att de inte matchar ett känt motiv i både sekvens och biologiskt sammanhang, vilket tyder på att posttranslationell reglering av proteinbeteende fortfarande till stor del outforskat. Dessa förutspådda motiv, av vilka många visar preferensassociation med specifika biologiska vägar och icke-slumpmässig positionering i den linjära proteinsekvensen, ger fokuserade hypoteser för experimentell validering.

Uttalande av intressekonflikt

Konkurrerande intressen: Författarna har förklarat att det inte finns några konkurrerande intressen.


Introduktion

I eukaryot evolution är den relativa betydelsen av horisontell genöverföring (HGT) jämfört med andra källor till genetisk nyhet (dvs. genduplicering, modifiering och de novo-ursprung) ett oklart ämne. Detta i motsats till Bacteria and Archaea, bland vilka HGT är etablerat som en viktig drivkraft för genetisk innovation (Ochman et al. 2000 Pál et al. 2005 Treangen och Rocha 2011). Även om HGTs inverkan på eukaryot evolution fortfarande är dåligt karakteriserad, har HGT varit inblandad i exploateringen av nya nischer av flera mikrobiella grupper, inklusive apicomplexans (Striepen et al. 2004), ciliater (Ricard et al. 2006), diplomonads (Andersson et al. al. 2003) och svampar (Slot och Hibbett 2007). Således kan HGT vara en betydande drivkraft för geninnovation i åtminstone vissa eukaryota linjer (Keeling och Palmer 2008 Andersson 2009). Men dålig upplösning vid basen av livets eukaryota träd samt bristen på nästa generations sekvensdata från mikrobiella eukaryoter komplicerar tolkningen av genfylogenier som annars tyder på HGT (recensat i Stiller 2011, se t.ex. Chan et al. 2012 Curtis et al. 2012 Deschamps och Moreira 2012).

Även om utmaningar kvarstår med att mäta och tolka HGT i eukaryoter, är genöverföring under utvecklingen av mitokondrier och plastider (dvs endosymbios) en väletablerad mekanism för genöverföring, en process som kallas endosymbiotisk genöverföring (EGT). Den primära plastiden hos Archaeplastida (dvs. röda, gröna och glaukofytiska alger, Adl et al. 2005) uppstod genom en endosymbiotisk association mellan cyanobakterier och en heterotrof, eukaryot värd (Douglas 1998).Den resulterande fotosyntetiska organellen, plastiden, upprätthåller ett reducerat genom på ≤200 gener, men majoriteten av generna som krävs för fotosyntesen har överförts till algvärdens kärngenom (Martin och Herrmann 1998). Många av dessa överförda gener riktas tillbaka till plastiden, men några har valts för att fungera i nya processer och därigenom öka den genetiska potentialen hos värdgenomet (Martin och Herrmann 1998). Plastidendosymbioser som involverar eukaryota alg-endosymbionts, snarare än cyanobakterier, distribuerade plastider och generna som var nödvändiga för att upprätthålla dem vidare över livets eukaryota träd (Archibald 2009).

Ett annat möjligt sätt för HGT i mikrobiella eukaryoter är förvärvet av genetiskt material under intag av bytesdjur (Doolittle 1998), vilket stöds av redovisningar av HGT i fagotrofa härstamningar såsom ciliater (Ricard et al. 2006), euglenider (Maruyama et al. 2011) ), och amöba (Eichinger et al. 2005). Ytterligare stöd för modellen för intag av bytesdjur kommer från alger (en icke-monofyletisk grupp av fotosyntetiska, plastid-innehållande eukaryoter). Även om primära plastid-innehållande organismer är strikta autotrofer, med få undantag, är många alger med plastider som härrör från ytterligare endosymbioser (t.ex. euglenider och dinoflagellater) mixotrofer som kompletterar fotosyntesen med konsumtion av matpartiklar (Stoecker 1998). När det gäller dessa mixotrofa alger förutspår hypotesen för intag av bytesdjur att dessa organismer kommer att ha gener förvärvade både från deras plastid och från deras byte (Doolittle 1998).

Dinoflagellaterna är protister (dvs mikrobiella eukaryoter) vanliga i många vattenmiljöer och är idealiska organismer för att undersöka HGTs inverkan på eukaryot evolution. Många dinoflagellat-arter är mixotrofer och har förmågan att erhålla kol från fotosyntes såväl som från intag av andra växtplankton och bakterier (Hackett, Anderson et al. 2004). Till stöd för modellen för intag av bytesdjur, tyder tidigare arbete på att dinoflagellatkärngenom innehåller ett stort antal gener förvärvade via plastid endosymbios såväl som gener horisontellt förvärvade från andra källor (Hackett et al. 2005, 2013 Nosenko et al. 2006 Nosenko och Bhattacharya 2007 Janouskovec m.fl. 2010 Minge m.fl. 2010 Wisecaver och Hackett 2010 Stuken m.fl. 2011 Chan m.fl. 2012 Orr m.fl. 2013). Placeringen av dinoflagellater är löst och väl underbyggd i fylogenetiska analyser, vilket är väsentligt för att sluta HGT baserat på fylogenetisk inkongruens mellan gen- och artträd. Dinoflagellater är syster till Perkinsidae, en parasitisk grupp som inkluderar ostronpatogenen Perkinsus marinus (Reece et al. 1997). Dinoflagellater och Perkinsidae är tillsammans syster till apicomplexans, en uteslutande parasitisk grupp som är ansvarig för många mänskliga sjukdomar inklusive malaria och toxoplasmos (Fast et al. 2002). Den närmaste större protistgruppen till dinoflagellater och apicomplexans är ciliaterna, och dessa tre linjer är tillsammans de primära medlemmarna i superfylum Alveolata (Adl et al. 2005). Fylogenetiska studier tyder på att alveolater är relaterade till stramenopiler (t.ex. kiselalger och jättekelp) och rhizarianer (t.ex. foraminifera och radiolarier), en association som förkortas till supergruppen stramenopile–alveolate–rhizaria (SAR) (Burki et al. 2007 Parfrey et al. 2010). Trots denna fylogenetiska upplösning såväl som publicerade fall av genöverföring, förblir den fulla omfattningen, timingen och konsekvenserna av HGT i dinoflagellater okända eftersom exempelgenom ännu inte har sekvenserats.

Dinoflagellatgenom varierar i storlek från 1,5 till 185 Gbp (0,8 till över 60 gånger storleken på det mänskliga genomet) och är fulla av icke-kodande sekvenser, tandemgenupprepningar och andra ovanliga egenskaper som gör genomsekvensering med nuvarande teknologi mycket opraktisk med nuvarande sammansättning teknologi (Wisecaver och Hackett 2011). Lyckligtvis är transkriptomsekvensering ett alternativt tillvägagångssätt för frågor som kräver omfattande genupptäckt i icke-modellorganismer med komplexa genom. Här analyserar vi en omfattande de novo transkriptomsammansättning för dinoflagellaten, Alexandrium tamarense stam CCMP1598, en medlem av "Group IV"-kladen inom A. tamarense artkomplex. Detta artkomplex består av fem sådana kladdgrupper som var och en troligen representerar en distinkt kryptisk art (Lilly et al. 2007). Vi korshänvisar våra A. tamarense Grupp IV-genuppsättning till transkriptomiska och uttryckta sekvenser taggar (EST) data från 21 ytterligare dinoflagellat-arter (inklusive transkriptomsammansättningar från A. tamarense Grupp I och Grupp III stammar) för att härleda en slutlig dinoflagellat unigenuppsättning som vi sedan jämför med 16 andra alg- och protistgenom. Med hjälp av rekonstruktion av förfäders geninnehåll kartlägger vi genförvärv på det alveolat-evolutionära trädet och validerar resultaten med hjälp av en fylogenomisk pipeline. Detta kombinerade tillvägagångssätt erbjuder en robust, jämförande utforskning av mönstret av HGT i dinoflagellater i förhållande till andra eukaryoter.


Diskussion

Som exempel på central och aminosyrametabolism i B. subtilis, visar vi att fluxomprofilering genom multivariat statistik från massisotopomerfördelningsanalys är meningsfull för diskriminering av mutanter eller tillstånd på grundval av deras metaboliska beteende och tillämplig på förhållanden som är otillgängliga för tidigare flödesanalys. I skarp kontrast till metabolomkoncentrationsdata [24, 25] innehåller fluxomprofiler funktionell information om driften av fullt sammansatta nätverk [1, 4]. Som visas här av ICA gör detta tillvägagångssätt det möjligt för oss att destillera de väsentliga signaturerna för oberoende metaboliska aktiviteter och stöder identifieringen av den underliggande biokemiska orsakssambandet. Eftersom ingen modell eller a priori kunskap om det undersökta systemet krävs, de metaboliska avtrycken av alla spåratomer och molekyler kan följas i praktiskt taget alla biologiska system, inklusive flercelliga organismer i komplexa multisubstratmedia.

Liknande, a priori kunskap om antalet IC som ska beräknas är inte en förutsättning. I själva verket beror det optimala antalet i första hand på märkningsmönstren och kan knappast uppskattas från datamängden. En underskattning kommer i allmänhet att lämna vissa relevanta signaturer okända, medan en överskattning kommer att leda till en ökad andel komponenter som reflekterar mätning eller biologiskt brus. Även om statistisk signifikans kan bedömas med dubbletter, blir detta oöverkomligt med stora datamängder (det vill säga hundratals mutanter eller analyter) eller minskad tillgänglighet av repliker. Flaskhalsen ligger i det stokastiska tillvägagångssättet för de flesta ICA-algoritmer, för vilka oberoende körningar resulterar i olika IC:er eller ordning därav. Istället kan den algoritmiska och statistiska tillförlitligheten för IC:erna utvärderas genom att upprepa uppskattningen flera gånger, antingen med slumpmässigt valda initiala gissningar eller genom att variera datasetet något (bootstrapping [28]), och sedan gruppera alla resultat för att identifiera robusta IC:er [29 ].

Två faktorer påverkar direkt de resultat som kan erhållas genom jämförande fluxomprofilering: de detekterade analyterna och valet av isotopspårämne. Förutom polymerbaserade analyter såsom de proteinogena aminosyrorna som övervakas här, kan fluxomprofiler detekteras i vilken uppsättning av intra- eller extracellulära metaboliter som helst, och därmed bredda de observerbara metaboliska processerna. Valet av spårämne beror till viss del på den metaboliska delsystem av intresse. Enhetligt märkta substrat ger ett mer globalt perspektiv eftersom de tillåter bedömning av förvrängningen av eventuell kolryggrad och, i fallet med experiment utförda i rika medier, även möjliggör kvantifiering av fraktionen av de novo biosyntes från spårämnet i förhållande till upptaget av en mediumkomponent. På liknande sätt, enhetligt deutererade substrat eller 2 H2O är värdefulla för att samtidigt fånga ett stort antal ICs som påverkas av frisättning, bindning och utbyte av vatten eller protoner. Substrat som är märkta vid specifika positioner möjliggör däremot djupare förfrågningar av särskilda undernätverk, till exempel [1-13C]hexoser för de initiala kataboliska reaktionerna [8, 19] eller [1-13C]aspartat för att bedöma ureacykelaktivitet.

Resultaten avslöjade också ny biologisk information om vägaktivitet, funktion eller reglering. För det första kataboliserade både glykolys och pentosfosfatvägen aktivt glukos i närvaro av CAA, eftersom pgi och yqjI mutantsignaturer skilde sig från vildtypen och från varandra. På sorbitol, däremot, var samma mutanter mycket lika vildtypen, vilket tyder på att båda reaktionerna endast marginellt är involverade i katabolism av detta socker. För det andra var Krebs-cykelflödet liknande på glukos och sorbitol (med och utan CAA), vilket härleds från de liknande uttalade signaturerna av sdhC mutant. För det tredje, frånvaro av sdhC signaturer i Krebs cykel-härledda aminosyror aspartat och glutamat av mdh mutant när den odlas med ammonium (men inte CAA) indikerar aktivitet av den äppelsyraenzymbaserade pyruvatbypass [30]. För det fjärde verkar aktiviteten hos det NADP-beroende äppelsyraenzymet vara oberoende av katabolitrepression eftersom uttalade signaturer av ytsJ mutant sågs på alla substrat. Det glukoneogena fosfoenolpyruvatsyntetaset Pps var däremot inaktivt i närvaro av det undertryckande glukoset men aktivt på pyruvat eller sorbitol. För det femte, som diskuterats ovan avslöjar data en Krebs-cykelfrämjande effekt av repressorn CggR på sorbitol men inte på glukos, troligen genom undertryckandet av glykolytiska gener [22].

Den jämförande fluxomprofileringen som presenteras här kompletterar traditionell flödesanalys eftersom den möjliggör potentiellt snabb och automatiserad identifiering av relevanta mutanter eller tillstånd från storskaliga datamängder, till exempel från hela mutantbibliotek. Tillvägagångssättet är kvantitativt i termer av den relativa skillnaden mellan varianter, men kvalitativt med avseende på in vivo flöde. Intressanta varianter utsätts sedan för djupare förhör av det specifika metabola fenomenet som identifierats. Förutom ren datautvinning har fluxomprofilering också potentialen att identifiera komplexa funktionella egenskaper i högre celler där nuvarande flödesmetoder misslyckas, och möjligen till och med identifiera den underliggande biokemiska mekanismen för diskriminerande massisotopsignaturer.


Metoder

Stammar och plasmider

E coli DH10B användes för kloning. E coli BLR (DE3) och DH1 användes för expressionsstudier med BglBrick-vektorer. Plasmider och BglBrick-delar som används i denna studie listas i tabell 1. Media kompletterades med 100 μg/mL ampicillin, 35 μg/mL kloramfenikol eller 50 μg/mL kanamycin för att välja för plasmidunderhåll. Alla stammar odlades vid 30°C om inte annat beskrivs.

Konstruktion av BglBrick vektordelar

Mallplasmiderna eller delarna för BglBrick-vektorerna som konstruerats här listas i Tabell 1 och primrarna för PCR-amplifiering listas i Tabell 2. Varje genkomponent har antingen PCR-amplifierats från en mall med Phusion™ High-Fidelity DNA-polymeras (New England) BioLabs, F-530) eller digereras från mallplasmider och införlivas i BglBrick-vektorplasmiden genom standard restriktionsdigerering/ligeringsmetod.

Replikationsursprung

p15A-ursprunget erhölls från plasmiden pZA31-luc, ColE1-ursprunget från plasmiden pZE12-luc och pSC101*-ursprunget från plasmiden pZS*24-MCS1 [39]. A BglII stället i pSC101*-ursprunget eliminerades genom platsriktad mutagenes. Oligonukleotiderna som används för att avlägsna BglII ställen i pSC101*-ursprunget var pSC101QC F1 och pSC101QC R1 som skapade pSC101**. Varje ursprung för replikering och terminatorsekvensmodul klonades in med användning av AvrII och SacI webbplatser. Plasmid pMBIS användes som mall för pBBRl-ursprunget. BBR1-regionen amplifierades i två delar, och primrar designades för att göra en C till T-punktsmutation i den överlappande regionen av de två PCR-produkterna för att öka kopiantalet som rapporterats [22]. Forward primer pBBR1 F1 (5'- gatcaCCTAGGctacagccgatagtctggaacagcgc -3') och omvänd primer pBBR1 mut R1 (5'- ccggcaccgtgtTggcctacgtggtc -3') användes för att generera den första produkten med en 5'-AvrII plats, och framåtriktad primer pBBR1 mut F1 (5'- gaccacgtaggccAacacggtgccgg -3') och omvänd primer pBBR1 R2 (5'- agatcaACTAGTgcctccggcctgcggcctgcgcgcttcg -3') användes för att generera den andra produkten med en 3'- SpeI webbplats. Dessa två delar kombinerades sedan i en splitsningsöverlappningsförlängnings-PCR (SOE-PCR)-reaktion med primrarna pBBR1 F1 och pBBR1 R2 för att skapa produkten innehållande hela pBBR1-replikationsstartpunkten. PCR-produkten digererades med AvrII och SpeI och ligerades med existerande intermediära vektorer för att generera ytterligare tre intermediära vektorer innehållande pBBR1 och varje antibiotikaresistensmodul.

Antibiotikaresistens

Alla antibiotikaresistenssegment (SacI till AatIIBglBrick-restriktionsstället som hittades i Cm- och Km-resistensgenkomponenter avlägsnades genom platsspecifik mutagenes. Oligonukleotiderna som används för att avlägsna EcoRI ställe i Cm-resistensgenen var den framåtriktade CmQC Fl (5'-ctttcattgccatacgAaattccggatgagcattc-3') och omvänd CmQC R1 (5'-gaatgctcatccggaattTcgtatggcaatgaaag-3') (punktmutation är versal). Oligonukleotiderna som används för att avlägsna BglII ställen i Km-resistensgenpromotorn var KanQC F1 (5'- cctgtctcttgatcagatcAtgatcccctgc-3') och KanQC R1 (5'- gcaggggatcaTgatctgatcaagagacagg-3').

Rfp (eller gfp) och terminator

rfp-terminator (rfp-term)-modulen konstruerades av skarvöverlappningsförlängnings-PCR (SOE-PCR [47]). Först utfördes SOE-PCR för att generera rfp med BglBrick-restriktionsplatser EcoRI och BglII och RBS (TTTAAGAAGGAGATATACAT) på 5'-änden och med BglBrick-restriktionsställen BamHI och XhoI och en dubbel terminatorsekvens följt av en AatII plats i 3'-änden. Två PCR utfördes för att amplifiera rfp och terminatorn separat, med användning av primrar för att introducera restriktionsställena, RBS och överlappande sekvens för SOE-PCR. Forward primer RFP F1 och reverse primer RFP R1 användes för att generera produkten innehållande EcoRI, Bglll, RBS och rfp. Forward primer Term F1 och omvänd primer Term R1 användes för att generera produkten innehållande BamHI, XhoI, den dubbla terminatorsekvensen och AvrII. Produkterna kombinerades sedan och en andra PCR utfördes med RFP F1 och Term R1. Den resulterande SOE-PCR-produkten (rfp-term) användes i sin tur i ytterligare SOE-PCR för att generera kompletta moduler innehållande de 8 olika promotorsystemen följt av rfp-termin.

Promotorer och förtryckare

Primerna för varje promotorsystem (innehållande repressor och promotor) konstruerades för att inkludera en 5'AatII webbplats för senare kloningssteg och en rfp överlappande sekvens på 3'-änden för att underlätta tillägget av rfp-terminatormodul via SOE-PCR. När promotorsystemet innehöll något av de 4 BglBrick-restriktionsställena, preparerades en ytterligare uppsättning primers för att avlägsna restriktionsstället för SOE-PCR. Primers för varje promotorsystem listas i tabell 2.

Slutlig pBb vektor montering

Att konstruera promotorsystemet med rfp-terminatormodul, var och en av de åtta promotorsystemmodulerna kombinerades med rfp-terminator genom SOE-PCR med användning av F1-primern från varje promotorsystemkonstruktion och den omvända primern Term R1. Dessa åtta produkter smältes sedan med AatII och AvrII och individuellt ligerad med AatII och AvrII digererat fragment från den intermediära plasmiden innehållande amp R och ColEl. De elva återstående intermediära plasmiderna digererades sedan med AvrII och AatII för att isolera modulerna för antibiotikaresistens-replikationsursprung (AR-ori). Totalt ligerades var och en av de tolv AR-ori-modulerna med var och en av de åtta AvrII och AatII digererade promotor-rfp-terminatormoduler för att producera 96 ​​unika pBb-vektorer.

Databladsexperiment

Allmän

Ampicillin-resistenta pBb-plasmider transformerades till E coli BLR(DE3) elektrokompetenta celler och/eller E coli DH1 elektrokompetenta celler och pläterade på LB-agar med 50 μg/ml karbenicillin (Cb) för inkubation över natten vid 37°C. En enda koloni plockades och användes för att förbereda frökulturen i LB-buljong innehållande 50 μg/ml Cb. Färska odlingsrör med 3 ml LB-buljong innehållande 50 μg/ml Cb inokulerades med 60 μl frökultur över natten och odlades vid 37°C, 200 rpm tills OD600 nådde cirka 0,55. Alla experiment replikerades i tre exemplar.

Inducerdosrespons

De yttre brunnarna på en 96-brunnars genomskinlig platta med lock (Corning nr: 3631) fylldes med 200 μl sterilt vatten och plattan steriliserades med hjälp av optimal tvärbindning inställning på UV-tvärbindaren (Spectronics, Corp.). 10 × serieutspädningar gjordes av inducerare lämpliga för varje plasmid som testades och 20 μl pipetterades i varje brunn så att den slutliga volymen på 200 μl skulle ge 1x inducerkoncentration. Varje platta inkluderade 3 kontrollbrunnar innehållande pBbE5a-RFP (eller GFP) i BLR(DE3) inducerad med 12,5 μM IPTG. Lämpliga volymer av odling och LB/Cb sattes till plattan med 96 brunnar med lock och odlades i en Safire (Tecan) mikroplattläsare vid 30°C under 20,5 timmar. OD600 och RFP-fluorescens mättes var 570:e sekund med användning av en excitationsvåglängd på 584 nm och en emissionsvåglängd på 607 nm. För konstruktionerna innehållande GFP (pBbB-plasmider) användes en excitationsvåglängd på 400 nm och en emissionsvåglängd på 510 nm för fluorescensmätning.

Ansträngning och medelberoende

E coli BLR(DE3) och DH1 transformerade med pBb-plasmid ströks på LB-agar med 50 μg/ml Cb och odlades vid 37°C över natten. Frökulturer bereddes i LB-buljong innehållande 50 μg/ml Cb inokulerade med en enda koloni och odlade vid 37°C, 200 rpm över natten. Varje experiment med en pBb-plasmidinnehållande stam replikerades i tre exemplar, och varje uppsättning experiment inkluderade 6 kontrollrör innehållande pBbE5a-RFP i BLR(DE3) i LB (3 oinducerade och 3 inducerade med 100 μM IPTG). För experimentet med M9 minimalt medium (MM) utfördes tre omgångar av anpassning i minimalt medium. Efter anpassning inokulerades färska rör med 3 mL färsk MM med anpassad frökultur till OD600 ca 0,15 och odlas vid 37°C till OD600 på cirka 0,5.En uppsättning rör inducerades vid olika inducerande koncentrationer och alla kulturer odlades vid 30°C, 200 rpm under 66 timmar efter induktion. Prover togs 18 timmar, 42 timmar och 66 timmar efter induktion. 25 μL kultur togs i en 96-brunnars platta och späddes till 200 μL med färskt medium och OD600 och fluorescens mättes. För LB- och TB-mediaexperiment användes frökulturer över natten direkt för inokulering utan anpassning.

Katabolitförtryck och inducerande överhörning

Frökulturer framställdes såsom beskrivits i experiment med stam- och mediumberoende. Tre olika medier (MM, fosfatbuffrad LB och fosfatbuffrad TB) innehållande 1% glukos användes för katabolitförtrycksexperiment. Inokulerade kulturer odlades vid 37°C till OD600 på cirka 0,5 och induceras för att uppnå maximalt uttryck (100 μM IPTG, 20 mM arabinos, 400 nM atC eller 20 mM propionat). Kulturer odlades vid 30°C, 200 rpm under 66 timmar efter induktion och OD600 och fluorescens mättes vid varje provtagning. För induceröverhörningsexperimentet inokulerades LB-buljong innehållande 50 μg/ml Cb med frökulturer innehållande E coli BLR(DE3) som hyser det ampicillinresistenta pBb. Kulturer inducerades vid OD600 av ungefär 0,5 med lämplig inducerare, och en av de icke-besläktade inducerarna sattes också till den individuellt inducerade kulturen under induktion. Kulturer odlades vid 30°C, 200 rpm under 18 timmar efter induktion och OD600 och fluorescens mättes med användning av Tecan.

Bakteriell DNA-isolering för att kvantifiera antalet plasmidkopior

E coli DH1 och BLR odlades över natten vid 30 ° C, 200 rpm skakning efter inokulering av 5 ml kulturer av LB-medium (kompletterat med 50 μg / ml kanamycin) med enstaka kolonier från nyligen strökade plattor. Efter subodling (1:50) i skakkolvar innehållande 50 ml LB-medium (kompletterat med 50 μg/ml kanamycin), odlades celler vid 30°C, 200 rpm skakning tills en OD600 på 0,3-0,4 nåddes. Vid denna tidpunkt snurrades 1 ml celler ner och supernatanten avlägsnades därefter. Cellpelletsen frystes sedan. Totalt DNA isolerades från dessa pellets för användning vid ett framtida datum. DNA-isoleringsmetoden som rapporterats i tidigare publikationer [33, 48] antogs. Bakteriecellpellets återsuspenderades i 400 μL 50 mM Tris/50 mM EDTA, pH 8, genom vortexning. Cellmembran permeabiliserades genom tillsats av 8 μL 50 mg/ml lysozym (Sigma) i 10 mM Tris/1 mM EDTA, pH 8, följt av inkubation vid 37°C i 30 minuter. För att fullborda cellysen tillsattes 4 μL 10 % SDS och 8 μL 20 mg/ml Proteinas K-lösning (Invitrogen) till varje rör, blandades med en spruta med 21-gauge, 1,5-tums nål och inkuberades vid 50° C i 30 min. Proteinas K värmeinaktiverades därefter vid 75°C i 10 minuter och RNA spjälkades med tillsats av 2 μL 100 mg/ml RNase A-lösning (Qiagen) följt av inkubation vid 37°C i 30 minuter. Total DNA-extraktion fortsatte sedan genom att tillsätta 425 μL av 25:24:1 fenol:kloroform:isoamylalkohol, och virvla kraftigt för

1 min, låt rören stå i rumstemperatur i några minuter och centrifugera sedan i 5 min vid 14 000 × g, 4°C. Därefter överfördes 300 μL av den övre vattenfasen till ett nytt rör med en vidöppningspipettspets. DNA-extraktionen fortsatte genom att tillsätta 400 μL kloroform till varje rör, kraftig vortexning för

1 min, låt rören stå i rumstemperatur i några minuter och centrifugering i 5 min vid 14 000 × g, 4°C. Därefter överfördes 200 μL av den övre vattenfasen till ett nytt rör med hjälp av en vidöppen pipettspets. Efter kloroformextraktion etanolfälldes totalt DNA över natten, tvättades med 70% etanol och suspenderades slutligen i 40 μL nukleasfritt vatten. DNA-koncentration och renhet analyserades med användning av en Nanodrop-spektrofotometer, och integriteten undersöktes på 1% agarosgeler.

Realtids qPCR-kvantifiering av plasmidkopienummer

Primeruppsättningar specifika för neomycin fosfotransferas II (nptII) gen (framåt: GCGTTGGCTACCCGTGATAT, omvänd: AGGAAGCGGTCAGCCCAT) [49] och 16S rDNA-gen (framåt: CCGGATTGGAGTCTGCAACT, omvänd: GTGGCATTCTGATCCACGATTAC) [33] användes för realtids-qPCR. Dessa primrar amplifierade en enda produkt av den förväntade storleken, vilket bekräftades av amplikonernas smälttemperaturer. nptII finns i en kopia på plasmiderna som karakteriseras i denna studie, medan 16S rDNA-genen finns på flera kopior på E coli kromosom [36] och användes för normalisering [22, 33, 35]. För att bestämma antalet plasmidkopior (dvs. antal plasmider per genomekvivalent), E coli DH1 och BLR transgena stammar med en singel nptII integration (data visas ej) användes för kalibrering. Totalt DNA isolerat från varje stam digererades först över natten med användning av EcoR I (New England Biolabs) vid 37°C. Realtids-qPCR utfördes på en BioRad iCycler med 96-brunnars reaktionsblock i närvaro av SYBR Green under följande förhållanden: 1X iQ SYBR Green Supermix (BioRad), 150 nM nptII (500 nM 16S) primrar i en 25 μL reaktion. qPCR-cykling i realtid var 95°C under 3 minuter, följt av 40 cykler på 30 sekunder vid 95°C, 30 sekunder vid 60°C och 30 sekunder vid 72°C. Tröskelcykler (Ct) bestämdes med iCycler (BioRad) programvara för alla prover. En standardkurva framställdes för kvantifiering. För detta ändamål bereddes en fyrfaldig spädningsserie med totalt sju spädningar från ett digererat totalt DNA-prov, och varje spädning utsattes för qPCR-analys i åtminstone duplikat med antingen nptII- eller 16S-specifika primers. Erhållna Ct-värden användes av iCyclers mjukvarupaket för att plotta en standardkurva som möjliggjorde kvantifiering av nptII eller 16S i de digererade totala DNA-proverna (dvs okända) i förhållande till DNA-provet som användes för att framställa standardkurvan.

Uttryckskontroll i treplasmidsystemet

BLR (DE3)-celler transformerades med tre plasmider: pBbA8a-CFP, pBbE5c-YFP och pBbS2k-RFP. En enda koloni användes för att inokulera LB-medium och kulturerna över natten odlades vid 37°C i minimalt medium (M9-medium levererat med 75 mM MOPS, 2 mM MgSO41 mg/L tiamin, 10 nM FeSO40,1 mM CaCl2 och mikronäringsämnen) kompletterat med 2 % glukos. Celler inducerades vid OD

0,6 med kombinationer av olika mängder arabinos, IPTG och aTc. I detalj var de använda arabinoskoncentrationerna 0, 5 mM och 20 mM. IPTG-koncentrationerna som användes var 0, 30 μM och 100 μM och de använda aTc-koncentrationerna var 0, 12,5 nM, 25 nM och 40 nM. Efter induktion odlades celler vid 30°C under 12 timmar tills cellodlingsfluorescensen mättes. Cellkulturfluorescens registrerades på en SpectraMax M2-plattläsare (Molecular Devices) med 96-brunnars Costar-plattor med varje brunn innehållande 150 μl cellkultur. För CFP, λex = 433 nm och Xem = 474 nm användes för YFP, λex = 500 nm och Xem = 530 nm användes och för RFP, λex = 584 nm och Xem = 615 nm användes. Celldensiteten uppskattades genom att mäta absorbansen vid 610 nm. Cellkulturfluorescens från varje brunn normaliserades av dess celldensitet. Alla data var genomsnittliga från minst två oberoende mätningar.


Titta på videon: Methanogenesis: Intestinal Biosynthesis of Methane (Augusti 2022).